[O] Exporting tables to ODS spreadsheets, with formatting?

[William Denton]

M-x org-table-export lets me export a table to a TSV or CSV file, which can be 
very useful, but it exports the pure text, so [[URL][links]] and such shows.


Exporting to ODT turns the table into a nice table in a word processing 
document, with URLs as links.


Is there a way to export a table to an ODS spreadsheet?  Has anyone hacked ODT 
export so that works, perhaps?


Bill
--
William Denton ↔  Toronto, Canada ↔  https://www.miskatonic.org/

[O] Showing DONE tasks in agenda?

[Peter Davis]

When I display my TODO items (with C-c a t), there's a line at the top 
of the buffer that says:


Available with `N r': (0)[ALL] (1)TODO (2)DONE

but I don't know what this means. How can I display all (TODO, DONE, 
whatever) items?


Typing 'N r' in the buffer doesn't do it.

Thanks,
-pd

[O] org-adapt-indentation

[Thomas S . Dye]

Aloha all,

Is the indentation performed when this variable is non-nil
cosmetic, or does it have an effect on Org mode processes such as
export, etc.?

All the best,
Tom
-- 
Thomas S. Dye
http://www.tsdye.com

Re: [O] convert a simple list of lines each to a orgmode header

[Thierry Banel]

  
  
No problem, this thread was useful:
  I learned C-c * and C-c - on region.
  
  Le 29/09/2015 15:13, Kaushal Modi a écrit :


  
Christian is correct.


Selecting a region and doing
  `C-c *` *does* work. Please ignore my earlier email. I mixed
  up some command in org that did not work over region with `C-c
  *` :)



  


  

  


  

Re: [O] undefined symbol 'org-export-create-backend' when calling org-plot/gnuplot

[Dave Marquardt]

Dave Marquardt  writes:

> Is this just a problem with the ELPA installation? I'm going to try
> removing and reinstalling the ELPA package, then if that doesn't change
> anything, try instaling from the Git tree.

I reinstalled the ELPA package, same result. I removed the ELPA package,
installed from the Git tree I cloned yesterday, same problem.

Next steps are to temporarily remove my Org customizations, and if that
fails, do some "git bisect" work to see if I can find out when this
broke.

-Dave

Re: [O] Latex compilation broken on orgmode master?

[William Denton]

On 29 September 2015, Kaushal Modi wrote:


Doing C-c C-e l o on any org file gives me the error

Symbol's value as variable is void: compile

If I use the latest org-mode-plus-contrib package from org elpa, latex
compilation works fine.

Can anyone using org git master confirm this?


I got that too, but restarting Emacs fixed it.

Bill
--
William Denton ↔  Toronto, Canada ↔  https://www.miskatonic.org/

Re: [O] Release Org 8.3.2

[Glyn Millington]

Bastien  writes:

> Hi all,
>
> Org 8.3.2, a bugfix release is out.
>
> Enjoy!


Thanks Bastien, and all involved.

atb

Glyn

[O] Add custom CSS class to code section?

[Williams, Ken]

Hi,

In http://orgmode.org/manual/CSS-support.html , I can see how to style 
Org-Mode's existing CSS classes in my exported HTML document.  What I can’t see 
is how to add a custom class to a code section, something like this:

#+BEGIN_SRC R :class foo
system.time( result <- doSomething() )
#+END_SRC

I want this because I’m trying to style some code blocks differently than 
others – specifically, I want some to be default-collapsed in my HTML output, 
and some to be default-expanded.

*Ideally* this would actually be controlled by highjacking the existing 
":exports" header argument, but I don’t know how to do that either.

Any tips?

 -Ken




CONFIDENTIALITY NOTICE: This e-mail message is for the sole use of the intended 
recipient(s) and may contain confidential and privileged information. Any 
unauthorized review, use, disclosure or distribution of any kind is strictly 
prohibited. If you are not the intended recipient, please contact the sender 
via reply e-mail and destroy all copies of the original message. Thank you.

Re: [O] "Capture"-like browser plugin?

[Peter Salazar]

For those of you on OSX, there's also an Alfred workflow for org-capture:
https://github.com/jjasghar/alfred-org-capture

org-capture from within any app with one keystroke...

On Fri, Sep 18, 2015 at 5:50 PM, Samuel Wales  wrote:

> fwiw my x logs contain some lines like these:
>
> Waiting for Emacs...
> Waiting for Emacs...*ERROR*: Capture abort: (end-of-file)
>
>

Re: [O] convert a simple list of lines each to a orgmode header

[Kaushal Modi]

Thanks Nick, I confirmed later that `C-c *` worked over region for me too.


--
Kaushal Modi

On Tue, Sep 29, 2015 at 9:27 PM, Nick Dokos  wrote:

> Kaushal Modi  writes:
>
> > I realized that the default binding `C-c *` works only on the current
> line, not the whole selection (and the same applies to the opposite `C-c
> -`).
> >
> > It would be great to have those commands work over a region too.
> >
>
> I don't think that's right - at least, when I tried it with a region, it
> worked. I just didn't know about it (or, more likely, didn't remember it)
> before Christian mentioned it.
>
> The docstring for the function says:
>
> ,
> | org-toggle-heading is an interactive Lisp function in
> | ‘../org-mode/lisp/org.el’.
> |
> | (org-toggle-heading  NSTARS)
> |
> | Convert headings to normal text, or items or text to headings.
> | If there is no active region, only convert the current line.
> `
>
> Is transient mark mode enabled? I think it's enabled by default
> nowadays, but maybe you turned it off?
>
> Nick
>
>
>
>
>

Re: [O] [gnorb] error when calling `gnorb-report-tracking-usage'

[Thomas Holst]

· Eric Abrahamsen  wrote:

>> Today I wanted to see how the registy is filled. I called
>> `gnorb-report-tracking-usage'. And got following error:
>>
>>   gnorb-registry-tracked-headings: Symbol's 
>>   function definition is void: hash-table-keys
>>
>> After a little search on the web I added:
>>
>>   #+begin_src emacs-lisp
>> (require 'subr-x)
>>   #+end_src
>>
>> to my gnorb config.

> Sorry, I didn't realize that was non-standard, I'll add a require.

>> Again calling `gnorb-report-tracking-usage' I get
>> another error:
>>
>>   eieio-default-superclass: Invalid slot name:
>>   "#", max-size
>>
>> Well I gave up on this. Couldn't dive deeper :-)
>>
>
> Ah, the problem here is that the Gnus registry got worked over a few
> months ago, but the changes are only in git master. I'll add a check to
> use the old slot name.
>
> There's a bigger problem, though -- the *reason* the registry got worked
> over is that there was a bug in it. You're supposed to be able to
> prevent some registry entries from getting garbage collected by putting
> a special 'precious tag on them, and that's what Gnorb does to prevent
> your records from getting wiped. In the release version of Gnus,
> however, there's a bug that results in precious entries getting pruned,
> as well. That's fixed in master, but not in the version you're using.
> You might consider using Gnus from git -- or I might consider adding
> a backwards-compatibility clobber-library...

Well I think I will try to install gnus from git repository. But it will
take a while until I will be able to do that.

At the moment I only have a few (< 50) mails associated with org. So I
don't expect a problem here. I just wanted to clean out stuff from my
testings.

Thanks for looking into this. Gnorb really makes my daily work a lot
more easy. To have org notes and all related emails at your fingertips
is so convinient :-)

-- 
Bis neulich ...
  Thomas

[O] Bug: doc string incorrect in org-icalendar-exclude-tags [8.3.2 (release_8.3.2-1-g115c4b @ /home/james/src/org-mode/lisp/)]

[james]

I've been trying to sort out the icalendar export bits. I've noticed the
docstring of (org-icalendar-exclude-tags) states that the tag can be set
with the ICAL_EXCLUDE_TAGS keyword. (it doesn't work). However in the
code of (org-export-define-derived-backend), the :exclude-tags of
:options-alist uses "ICALENDAR_EXCLUDE_TAGS". The does work as a file
level keyword.

In an org file:

#+ICAL_EXCLUDE_TAGS: NOICAL


* Headline to not export :NOICAL:

(org-icalendar-combine-agenda-files) any dates in the headline are
exported to the ics file.

But instead:

#+ICALENDAR_EXCLUDE_TAGS: NOICAL

* Headline to not export   :NOICAL:

(org-icalendar-combine-agenda-files) does not export any dates in the
headline to the ics file.

Could the docstring be updated to say "ICALENDAR_EXCLUDE_TAGS"? It may
save confusion for the next person looking at this.

Thanks.

Oh, and I realize I'm not on the HEAD, but

~/src/org-mode (stable) $ git diff origin/HEAD -- lisp/ox-icalendar.el 
~/src/org-mode (stable) $ 


Emacs  : GNU Emacs 24.5.1 (x86_64-pc-linux-gnu, GTK+ Version 3.16.4)
 of 2015-06-28 on trouble, modified by Debian
Package: Org-mode version 8.3.2 (release_8.3.2-1-g115c4b @ 
/home/james/src/org-mode/lisp/)
Sent with my mu4e

Re: [O] bug: latex exporter

[Rainer M Krug]

Rasmus  writes:

> Hi Charles,
>
> Charles Millar  writes:
>
>> Since Monday morning (New York time) I have not been able to export to
>> pdflatex (worked OK the night before). Instead the message buffer
>> reads
>
> Yeah, sorry about the inconvenience!
>
> Please try to update to 679adcaa64613c821b38cd1d34b081640315293a (current
> head) and let me know if this does not solve the issue.

Yup - working again.

Thanks

Rainer

>
> Rasmus

-- 
Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation Biology, 
UCT), Dipl. Phys. (Germany)

Centre of Excellence for Invasion Biology
Stellenbosch University
South Africa

Tel :   +33 - (0)9 53 10 27 44
Cell:   +33 - (0)6 85 62 59 98
Fax :   +33 - (0)9 58 10 27 44

Fax (D):+49 - (0)3 21 21 25 22 44

email:  rai...@krugs.de

Skype:  RMkrug

PGP: 0x0F52F982


signature.asc
Description: PGP signature

Re: [O] org export outcomes differ from one attempt to the next

[Eric S Fraga]

On Monday, 21 Sep 2015 at 22:25, Nicolas Goaziou wrote:
> Providing a shorter test file would be helpful, no matter how much
> settings you have.

Hi Nicolas,

Sorry for the delay in getting back to you.  I have been working on this
document over the past 10 days, getting ready for the new academic
year.  This particular file is the complete set of slides for a whole
course.  It is very long and brings in all kinds of bits from org,
primarily beamer export, babel for a number of languages and has a lot
of embedded LaTeX.

I have not been able to create smaller example that demonstrates the
problem.

I *have* however solved (to use the term loosely) the problem by moving
all of the #+latex_header settings to the start of the file instead of
the end.  They remain within a separate :noexport: section.  Only their
actual location in the file has changed.

I usually put these at the end because I also use emacs file variables
for settings specific to the document and these are always at the end of
the file (for me, anyway).  These emacs settings remain at the end.

I wish I could provide more insight into the problem but, at least for
now, I am able to get my ~700 slides ready for teaching this term!  My
gut feeling, nonetheless, is that I have something in one of the 700
slides that confuses the org parser somehow so that by the time the end
of the file is reached, some data structures are inconsistent.  But who
knows?

Thanks for your help,
eric

-- 
: Eric S Fraga (0xFFFCF67D), Emacs 25.0.50.2, Org release_8.3.1-270-g256fef

[O] Capture abort: (user-error Can't preview LaTeX fragment in a non-file buffer)

[Fanpeng Kong]

Hi all,

I tried to setup my org-mode according to Bernt Hansen 
’s
 wonderful documentation:

http://doc.norang.ca/org-mode.html#Capture 


But later I found I got problem with Org Capture as in Section 6. when I typed 
C-c c, an error message "Capture abort: (user-error Can't preview LaTeX 
fragment in a non-file buffer)” occured. After lots of search on the web I 
still can not solve it. I am wondering is there anyone can help me out? Thanks 
in advance!

Things I have tried:
1. Test Latex preview in org file: 
http://orgmode.org/worg/org-tutorials/org-latex-preview.html 

Both “dvipng” and “imagemagick” setup methods work fine, I can preview 
Latex formula in .org file.

2. Use the method described here: 
http://orgmode.org/cgit.cgi/org-mode.git/commit/?id=168c5584f5a41c4c0890f4caa89fc11cff021c4e
 

I replace my “org-mode” package with the one in the link which is 
supposed to solve the problem, however, I still got the same error message.

Versions of some packages I am using:
1. Emacs: GNU Emacs 24.4.1 (x86_64-apple-darwin13.4.0, NS apple-appkit-1265.21) 
of 2014-10-21 on builder10-9.porkrind.org 
2. AucTeX: 11.88.8
3. org-mode: Org-mode version 8.3.1 (8.3.1-146-gfd8a18-elpa @ 
/Users/xiaok/.emacs.d/elpa/org-20150928/) 

Cheers,
Fanpeng

[O] capture: create or append to existing heading, by date

[Tamas Papp]

Hi,

I am tracking calories using tables like this:

--8<---cut here---start->8---
** [2015-10-01 Thu]
|   | food | quantity | kcal/unit |  kcal |
|---+--+--+---+---|
|   |  |  ||   |
| # | pepper_bell  |  100 |57/100 |  57.0 |
| # | cheese_Old_Amsterdam |   20 |   429/100 |  85.8 |
| # | mustard  |   15 |   105/100 |  15.8 |
| # | egg  |3 |88 | 264.0 |
| # | chocolate_dark   |   10 |   550/100 |  55.0 |
|---+--+--+---+---|
| # |  |  || 477.6 |
#+TBLFM: $4='(diet-lookup-calories $2)::$5=$3*$4;%0.1f::@>$5=vsum(@<<<..@>>)
--8<---cut here---end--->8---

(diet-lookup-calories is a function that looks up calories from another
table).

I need help with the following: the tables are organized daily, with
dates in the headings as above. I would like to have a capture process
where

1. if there is no table for today, create it, capture,
2. if there is a table for today, take me there and capture.

Currently I have implemented 1. with the org-capture-template

--8<---cut here---start->8---
("f" "food diary" entry (file+olp "~/org/calories.org" "diary")
 "* %u
|   | food | quantity  | kcal/unit   |  kcal |
|---+--+---+-+---|
|   |  |   |  |   |
| # |  |   | |   |
|---+--+---+-+---|
| # |  |   |  |   |
#+TBLFM: $4='(diet-lookup-calories $2)::$5=$3*$4;%0.1f::@>$5=vsum(@<<<..@>>)
")
--8<---cut here---end--->8---

but it would be great if I had an automated process where tables are
created for the first capture of the day, then appended to after.

Thanks,

Tamas

Re: [O] Add custom CSS class to code section?

[Christian Moe]

Hi,

#+BEGIN_foo
#+BEGIN_SRC R 
  system.time( result <- doSomething() )
#+END_SRC
#+END_foo

will wrap your code section in a  element.

Yours,
Christian

Williams, Ken writes:

> Hi,
>
> In http://orgmode.org/manual/CSS-support.html , I can see how to style 
> Org-Mode's existing CSS classes in my exported HTML document.  What I can’t 
> see is how to add a custom class to a code section, something like this:
>
> #+BEGIN_SRC R :class foo
> system.time( result <- doSomething() )
> #+END_SRC
>
> I want this because I’m trying to style some code blocks differently than 
> others – specifically, I want some to be default-collapsed in my HTML output, 
> and some to be default-expanded.
>
> *Ideally* this would actually be controlled by highjacking the existing 
> ":exports" header argument, but I don’t know how to do that either.
>
> Any tips?
>
>  -Ken
>
>
> 
>
> CONFIDENTIALITY NOTICE: This e-mail message is for the sole use of the 
> intended recipient(s) and may contain confidential and privileged 
> information. Any unauthorized review, use, disclosure or distribution of any 
> kind is strictly prohibited. If you are not the intended recipient, please 
> contact the sender via reply e-mail and destroy all copies of the original 
> message. Thank you.

Re: [O] Showing DONE tasks in agenda?

[Eric S Fraga]

On Wednesday, 30 Sep 2015 at 12:13, Peter Davis wrote:
> When I display my TODO items (with C-c a t), there's a line at the top
> of the buffer that says:
>
> Available with `N r': (0)[ALL] (1)TODO (2)DONE
>
> but I don't know what this means. How can I display all (TODO, DONE,
> whatever) items?
>
> Typing 'N r' in the buffer doesn't do it.

I think the N refers to the numeric choice (0, 1 or 2).  Have you tried,
for instance, typing "2 r"?
-- 
: Eric S Fraga (0xFFFCF67D), Emacs 25.0.50.2, Org release_8.3.1-270-g256fef

[O] [PATCH] ob-python: Fix python session initialization

[Grégoire Jadi]

Hi,

There is a bug in ob-python, the parameters aren't used to initialize
the session. Here is a patch that fixes it.

OK to push ?

* lisp/ob-python.el (org-babel-execute:python): Send params to 
`org-babel-python-initiate-session'.

It was not possible to configure the sesssion with custom parameters.
For example, the python interpreter with :python
> BEGIN_SRC python :session my-session :python ipython
---
 lisp/ob-python.el | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/lisp/ob-python.el b/lisp/ob-python.el
index 3a9b8f6..f2e6f66 100644
--- a/lisp/ob-python.el
+++ b/lisp/ob-python.el
@@ -74,7 +74,7 @@ This will typically be either `python' or `python-mode'."
   "Execute a block of Python code with Babel.
 This function is called by `org-babel-execute-src-block'."
   (let* ((session (org-babel-python-initiate-session
-  (cdr (assoc :session params
+  (cdr (assoc :session params)) params))
  (result-params (cdr (assoc :result-params params)))
  (result-type (cdr (assoc :result-type params)))
 (return-val (when (and (eq result-type 'value) (not session))
-- 

-- 
Grégoire Jadi


signature.asc
Description: PGP signature

Re: [O] [PATCH] ob-python: Fix python session initialization

[Grégoire Jadi]

Grégoire Jadi writes:

> Hi,
>
> There is a bug in ob-python, the parameters aren't used to initialize
> the session. Here is a patch that fixes it.

Err, discard this. It's not enough to fix the bug since
`org-babel-python-initiate-session' doesn't use the params either. I'll
come back later with a correct patch (unless someone else is faster ;)).

Sorry for the noise.

Cheers

> OK to push ?
>
> * lisp/ob-python.el (org-babel-execute:python): Send params to 
> `org-babel-python-initiate-session'.
>
> It was not possible to configure the sesssion with custom parameters.
> For example, the python interpreter with :python
>> BEGIN_SRC python :session my-session :python ipython
> ---
>  lisp/ob-python.el | 2 +-
>  1 file changed, 1 insertion(+), 1 deletion(-)
>
> diff --git a/lisp/ob-python.el b/lisp/ob-python.el
> index 3a9b8f6..f2e6f66 100644
> --- a/lisp/ob-python.el
> +++ b/lisp/ob-python.el
> @@ -74,7 +74,7 @@ This will typically be either `python' or `python-mode'."
>"Execute a block of Python code with Babel.
>  This function is called by `org-babel-execute-src-block'."
>(let* ((session (org-babel-python-initiate-session
> -(cdr (assoc :session params
> +(cdr (assoc :session params)) params))
>   (result-params (cdr (assoc :result-params params)))
>   (result-type (cdr (assoc :result-type params)))
>(return-val (when (and (eq result-type 'value) (not session))
> -- 

-- 
Grégoire Jadi


signature.asc
Description: PGP signature

[O] Bug: Error on preview of latex equation [8.3.2 (release_8.3.2-138-g679adc @ /Users/rainerkrug/.emacs.d/org-mode/lisp/)]

[Rainer M Krug]

Sometimes after wo=rking in a document with many latex formulas I get,
when trying to preview a new formula I get the folowing error:

,
| org-remove-if: Wrong type argument: number-or-marker-p, nil
`

Closing the document and re-opening fixes it for some time and then it
re-occurs.

Here is the backtrace:

,
| Debugger entered--Lisp error: (wrong-type-argument number-or-marker-p nil)
|   #[(o) "\304!   Y\205.\305!\nX\205.\306!\210\206.\307\211.\207" 
[o beg end removedp overlay-start overlay-end delete-overlay t] 2](#)
|   org-remove-if(#[(o) "\304! 
Y\205.\305!\nX\205.\306!\210\206.\307\211.\207" [o beg end removedp 
overlay-start overlay-end delete-overlay t] 2] (# 
# # # # # # # # # # # # # # # # # #))
|   org-remove-latex-fragment-image-overlays(6553 6802)
|   org-toggle-latex-fragment(nil)
|   funcall-interactively(org-toggle-latex-fragment nil)
|   call-interactively(org-toggle-latex-fragment nil nil)
|   command-execute(org-toggle-latex-fragment)
`


Emacs  : GNU Emacs 25.0.50.1 (x86_64-apple-darwin14.5.0, NS appkit-1348.17 
Version 10.10.5 (Build 14F27))
 of 2015-09-29
Package: Org-mode version 8.3.2 (release_8.3.2-138-g679adc @ 
/Users/rainerkrug/.emacs.d/org-mode/lisp/)

current state:
==
(setq
 org-src-lang-modes '(("plantuml" . plantuml) ("ocaml" . tuareg) ("elisp" . 
emacs-lisp) ("ditaa" . artist) ("asymptote" . asy) ("dot" . fundamental)
  ("sqlite" . sql) ("calc" . fundamental) ("C" . c) ("cpp" 
. c++) ...)
 org-hide-leading-stars t
 org-tab-first-hook '(org-hide-block-toggle-maybe 
org-babel-hide-result-toggle-maybe org-babel-header-arg-expand)
 org-speed-command-hook '(org-speed-command-default-hook 
org-babel-speed-command-hook)
 org-notmuch-search-open-function 'org-notmuch-search-follow-link
 org-ellipsis " [...]"
 org-occur-hook '(org-first-headline-recenter)
 org-src-tab-acts-natively t
 org-metaup-hook '(org-babel-load-in-session-maybe)
 org-imenu-depth 6
 org-html-format-drawer-function '(lambda (name contents) contents)
 org-src-window-setup 'current-window
 org-latex-format-inlinetask-function 
'org-latex-format-inlinetask-default-function
 org-confirm-shell-link-function 'y-or-n-p
 org-ascii-format-inlinetask-function 'org-ascii-format-inlinetask-default
 org-latex-format-headline-function 'org-latex-format-headline-default-function
 org-startup-indented t
 org-after-todo-state-change-hook '(org-clock-out-if-current)
 org-latex-format-drawer-function '(lambda (name contents) contents)
 org-from-is-user-regexp "\\"
 org-src-mode-hook '(org-src-babel-configure-edit-buffer 
org-src-mode-configure-edit-buffer)
 org-agenda-before-write-hook '(org-agenda-add-entry-text)
 org-babel-pre-tangle-hook '(save-buffer)
 org-mode-hook '(rmk/org-mark-readonly (lambda nil (imenu-add-to-menubar 
"Imenu")) turn-on-org-cdlatex (lambda nil (flyspell-mode 1))
 #[nil
   "\305.\306   
>\203.\307\n\310\311#\210\307\312\313#\210\307\314\315#\210\306  
>\203,.\307\n\316\317#\210\307\n\320\321#\210\322   
>\203>.\307\323\324#\210\307\325\324#\210\326 
>\203P.\307\n\327\317#\210\307\n\330\321#\210\331   
>\203_.\332\311\f\333BC\334#\210\335>\203k.\332\311\336\334#\210\337
>\203w.\332\311\340\334#\210\341\342\343\344\311$\210\345\342\311\"\210\342\207"
   [org-mouse-context-menu-function

org-mouse-features

org-mouse-map

org-mode-map

org-outline-regexp

org-mouse-context-menu

context-menu

org-defkey

[mouse-3]

nil ...]
   5]
 rmk/prettier-org-code-blocks #[nil "\300\301\302\303\304$\207" 
[org-add-hook change-major-mode-hook org-show-block-all append local] 5]
 #[nil "\300\301\302\303\304$\207" [org-add-hook 
change-major-mode-hook org-babel-show-result-all append local] 5]
 org-babel-result-hide-spec org-babel-hide-all-hashes)
 org-refile-targets '((nil :maxlevel . 5))
 org-archive-hook '(org-attach-archive-delete-maybe)
 org-ascii-format-drawer-function '(lambda (name contents width) contents)
 org-ctrl-c-ctrl-c-hook '(org-babel-hash-at-point 
org-babel-execute-safely-maybe)
 org-cycle-hook '(org-cycle-hide-archived-subtrees org-cycle-hide-drawers 
org-cycle-show-empty-lines org-optimize-window-after-visibility-change)
 org-plantuml-jar-path "/Users/rainerkrug/jar/plantuml.jar"
 org-notmuch-open-function 'org-notmuch-follow-link
 org-export-before-processing-hook '(rmk/remove-lines-with-ignore-heading-tag)
 org-modules '(org-bbdb org-bibtex org-docview org-gnus org-info org-irc 
org-mhe org-rmail org-w3m org-mac-link)
 

Re: [O] Showing DONE tasks in agenda?

[Kyle Meyer]

Hello,

Peter Davis  writes:

> When I display my TODO items (with C-c a t), there's a line at the top
> of the buffer that says:
>
> Available with `N r': (0)[ALL] (1)TODO (2)DONE
>
> but I don't know what this means. How can I display all (TODO, DONE,
> whatever) items?
>
> Typing 'N r' in the buffer doesn't do it.

Replace N with the number (e.g., 2 for DONE).

-- 
Kyle

Re: [O] Showing DONE tasks in agenda?

[Peter Davis]

Eric S Fraga  writes:

> On Wednesday, 30 Sep 2015 at 12:13, Peter Davis wrote:
>> When I display my TODO items (with C-c a t), there's a line at the top
>> of the buffer that says:
>>
>> Available with `N r': (0)[ALL] (1)TODO (2)DONE
>>
>> but I don't know what this means. How can I display all (TODO, DONE,
>> whatever) items?
>>
>> Typing 'N r' in the buffer doesn't do it.
>
> I think the N refers to the numeric choice (0, 1 or 2).  Have you tried,
> for instance, typing "2 r"?

Ah! Thank you, Eric. That seems to explain it, except ...

'0 r' and '1 r' both show the same thing ... just TODO items. '2 r' shows me 
just DONE items, so none of the options shows both TODO
and DONE items.

Thank you!

Re: [O] Bug: doc string incorrect in org-icalendar-exclude-tags [8.3.2 (release_8.3.2-1-g115c4b @ /home/james/src/org-mode/lisp/)]

[Nicolas Goaziou]

Hello,

ja...@jamestechnotes.com writes:

> I've been trying to sort out the icalendar export bits. I've noticed the
> docstring of (org-icalendar-exclude-tags) states that the tag can be set
> with the ICAL_EXCLUDE_TAGS keyword. (it doesn't work). However in the
> code of (org-export-define-derived-backend), the :exclude-tags of
> :options-alist uses "ICALENDAR_EXCLUDE_TAGS". The does work as a file
> level keyword.

Fixed. Thank you.

Regards,

-- 
Nicolas Goaziou

Re: [O] bug: latex exporter

[Charles Millar]

On 10/01/2015 09:07 AM, Rainer M Krug wrote:

Kaushal Modi  writes:


It seems as if no one got the email I sent out yesterday, very odd.
On Sep 30, 2015 4:59 PM, "Charles Millar"  wrote:

This is indeed a twisted and strange thread...

Not only this thread but the list for about two days. At times over 24 
hours elapsed before a message showed up.
It appears that this bug relating to the latex exporter was reported 
three times. According to the dates Rainer Krug first reported it at 
05:11 on Sep 29; before I sent my message (this thread on Sep 29 at 
05:37) ) I checked to see if it had been reported and nothing showed. 
Kushai apparently sent his report a few hours later. AFIK none of these 
were on the list for several hours.


I checked gmane and the org list as well as my email for any replies. I 
discovered that the exporter bug had been fixed when I looked at the 
orgmode git site, so I posted a thank you. Again, at that time I posted, 
nothing on the list reported the fix had been taken care of, although it 
is obvious that two hours before I sent that message Nick and Rasmus had 
posted messages to that effect.


Since this morning everything seems fine.

Above are just observations, nothing more.

Charlie

I see that Rasmus has fixed this. Thank you.

On 09/29/2015 03:00 PM, Rainer M Krug wrote:


Envoyé de mon iPhone

Le 29 sept. 2015 à 11:37, Charles Millar  a écrit :

Since Monday morning (New York time) I have not been able to export to
pdflatex (worked OK the night before). Instead the message buffer reads

symbol's value as variable is void - compile

GNU Emacs 24.3.1 (x86_64-pc-linux-gnu, GTK+ Version 3.10.7) of
2014-03-07 on lamiak, modified by Debian
Org-mode version 8.3.1 (release_8.3.1-283-gf6187d @
/usr/share/emacs/site-lisp/org-mode/lisp/)

I can confirm this - please see my other post for an example.

Rainer

Charlie Millar

Re: [O] bug: latex exporter

[Rainer M Krug]

Kaushal Modi  writes:

> It seems as if no one got the email I sent out yesterday, very odd.
> On Sep 30, 2015 4:59 PM, "Charles Millar"  wrote:

This is indeed a twisted and strange thread...


>
>> I see that Rasmus has fixed this. Thank you.
>>
>> On 09/29/2015 03:00 PM, Rainer M Krug wrote:
>>
>>>
>>> Envoyé de mon iPhone
>>>
>>> Le 29 sept. 2015 à 11:37, Charles Millar  a écrit :

 Since Monday morning (New York time) I have not been able to export to
 pdflatex (worked OK the night before). Instead the message buffer reads

 symbol's value as variable is void - compile

 GNU Emacs 24.3.1 (x86_64-pc-linux-gnu, GTK+ Version 3.10.7) of
 2014-03-07 on lamiak, modified by Debian
 Org-mode version 8.3.1 (release_8.3.1-283-gf6187d @
 /usr/share/emacs/site-lisp/org-mode/lisp/)

 I can confirm this - please see my other post for an example.
>>>
>>> Rainer
>>>
>>> Charlie Millar


>>
>>
>>
>

-- 
Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation Biology, 
UCT), Dipl. Phys. (Germany)

Centre of Excellence for Invasion Biology
Stellenbosch University
South Africa

Tel :   +33 - (0)9 53 10 27 44
Cell:   +33 - (0)6 85 62 59 98
Fax :   +33 - (0)9 58 10 27 44

Fax (D):+49 - (0)3 21 21 25 22 44

email:  rai...@krugs.de

Skype:  RMkrug

PGP: 0x0F52F982


signature.asc
Description: PGP signature

Re: [O] undefined symbol 'org-export-create-backend' when calling org-plot/gnuplot

[Dave Marquardt]

Dave Marquardt  writes:

> Dave Marquardt  writes:
>
>> Is this just a problem with the ELPA installation? I'm going to try
>> removing and reinstalling the ELPA package, then if that doesn't change
>> anything, try instaling from the Git tree.
>
> I reinstalled the ELPA package, same result. I removed the ELPA package,
> installed from the Git tree I cloned yesterday, same problem.
>
> Next steps are to temporarily remove my Org customizations, and if that
> fails, do some "git bisect" work to see if I can find out when this
> broke.

I did git bisect on a couple of x86_64 Linux systems:
- RHEL 6.7 with Emacs 24.3.2
- Fedora 22 with Emacs 24.5.1

The result was

# first bad commit: [6d2ab4071960f8a7f20138291424b468722ab522] org-table: Fix 
radio tables containing macros

The table I ran M=x org-plot/gnuplot on was from the Org Mode info page
"Org-Plot":

 #+PLOT: title:"Citas" ind:1 deps:(3) type:2d with:histograms set:"yrange 
[0:]"
 | Sede  | Max cites | H-index |
 |---+---+-|
 | Chile |257.72 |   21.39 |
 | Leeds |165.77 |   19.68 |
 | Sao Paolo | 71.00 |   11.50 |
 | Stockholm |134.19 |   14.33 |
 | Morelia   |257.56 |   17.67 |

Stack backtrace is as mentioned earlier:

Debugger entered--Lisp error: (void-function org-export-create-backend)
  org-export-create-backend(:parent org :transcoders ((table lambda
(table contents info) (concat nil contents nil)) (table-row lambda
(row contents info) (if (eq (org-element-property :type row) (quote
rule)) nil (let ((headerp (org-export-table-row-in-header-p row info))
(lastp (not (org-export-get-next-element row info))) (last-header-p
(org-export-table-row-ends-header-p row info))) (when contents (cond
nil nil nil (t (concat ...))) (table-cell lambda (cell contents
info) (let ((headerp (org-export-table-row-in-header-p
(org-export-get-parent-element cell) info)) (column (1+ (cdr
(org-export-table-cell-address cell info) nil (when contents nil
(cond nil (t (setq contents (funcall ... contents) (if (or nil
(plist-get info :orgtbl-ignore-sep) (not (org-export-get-next-element
  cell info))) contents (concat contents "  " (macro lambda (m c i) 
(org-element-macro-interpreter m nil
  orgtbl-to-generic((("*Total time*" "*4:11*" "" "100.0") ("Time"
"4:11" "" "100.0") ("CMVC" "" "0:21" "8.4") ("Connections" "" "0:23"
"9.2") ("DAT" "" "0:02" "0.8") ("Defects" "" "1:24" "33.5")
("developerWorks" "" "0:02" "0.8") ("Mail" "" "0:39" "15.5") ("RDS" ""
"0:06" "2.4") ("SDB" "" "0:01" "0.4") ("SDN" "" "0:01" "0.4") ("SMC-R"
"" "0:01" "0.4") ("Startup" "" "0:27" "10.8") ("TCP" "" "0:02" "0.8")
("Team" "" "0:42" "16.7")) (:sep " " :fmt org-plot-quote-tsv-field
:plot-type 2d :with histograms :ind 1 :labels ("Headline" "Time" ""
"%") :set ("style fill solid") :deps (4)))
  org-plot/gnuplot-to-data((("*Total time*" "*4:11*" "" "100.0")
("Time" "4:11" "" "100.0") ("CMVC" "" "0:21" "8.4") ("Connections" ""
"0:23" "9.2") ("DAT" "" "0:02" "0.8") ("Defects" "" "1:24" "33.5")
("developerWorks" "" "0:02" "0.8") ("Mail" "" "0:39" "15.5") ("RDS" ""
"0:06" "2.4") ("SDB" "" "0:01" "0.4") ("SDN" "" "0:01" "0.4") ("SMC-R"
"" "0:01" "0.4") ("Startup" "" "0:27" "10.8") ("TCP" "" "0:02" "0.8")
("Team" "" "0:42" "16.7")) "/tmp/org-plot18132EYn" (:plot-type 2d
:with histograms :ind 1 :labels ("Headline" "Time" "" "%") :set
("style fill solid") :deps (4)))
  org-plot/gnuplot()
  call-interactively(org-plot/gnuplot record nil)
  command-execute(org-plot/gnuplot record)
  execute-extended-command(nil "org-plot/gnuplot")
  call-interactively(execute-extended-command nil nil)

-Dave

Re: [O] bug: latex exporter

[Nick Dokos]

Kaushal Modi  writes:

> It seems as if no one got the email I sent out yesterday, very odd.
>

Yes, I think gmane had problems. They seem to be fixed now: at least,
I've seen the couple of replies that I had posted.

-- 
Nick

Re: [O] Showing DONE tasks in agenda?

[Nick Dokos]

Peter Davis  writes:

> When I display my TODO items (with C-c a t), there's a line at the top
> of the buffer that says:
>
> Available with `N r': (0)[ALL] (1)TODO (2)DONE
>
> but I don't know what this means. How can I display all (TODO, DONE,
> whatever) items?
>
> Typing 'N r' in the buffer doesn't do it.
>

Try '0 r' or '1 r' or '2 r'.

-- 
Nick

Re: [O] Delays in posting

[Kaushal Modi]

Yes, that seems to be the problem. I subscribe to the mailing list directly
and access the emails as threads in Gmail.


--
Kaushal Modi

On Thu, Oct 1, 2015 at 11:57 AM, Nick Dokos  wrote:

> This is just an FYI.
>
> Over the past couple of days, I've noticed delays in posting.
> I posted a couple of things two days ago that didn't show up
> until one day later. I believe a couple of other people have
> noticed the same thing. I figured that since the posts *did*
> show up, the problems were resolved, but another post from this
> morning still hasn't shown up four hours later.
>
> I use Gnus/nntp to get to news.gmane.org, not email, so I
> believe the problem is with gmane, but this is just a guess.
>
> Nick
>
>
>

[O] Delays in posting

[Nick Dokos]

This is just an FYI.

Over the past couple of days, I've noticed delays in posting.
I posted a couple of things two days ago that didn't show up
until one day later. I believe a couple of other people have
noticed the same thing. I figured that since the posts *did*
show up, the problems were resolved, but another post from this
morning still hasn't shown up four hours later.

I use Gnus/nntp to get to news.gmane.org, not email, so I
believe the problem is with gmane, but this is just a guess.

Nick

[O] Different set of packages for LaTeX export

[Manfred Lotz]

Hi all,
I have configured LaTeX export for using xelatex. For this I have
defined a list of packages in org-latex-default-packages-alist. One of
those packages is hyperref with certain options.

When creating a normal document, e.g. using class article that works
fine.

When creating slides, i.e using beamer I get an option clash
during compiling the tex file because beamer did already load hyperref.

How can I solve it? 

Could I have a different package list if the class is beamer?


-- 
Manfred

Re: [O] Delays in posting

[Charles Millar]

Hi Nick,

On 10/01/2015 11:57 AM, Nick Dokos wrote:

This is just an FYI.

Over the past couple of days, I've noticed delays in posting.
I posted a couple of things two days ago that didn't show up
until one day later. I believe a couple of other people have
noticed the same thing. I figured that since the posts *did*
show up, the problems were resolved, but another post from this
morning still hasn't shown up four hours later.

I use Gnus/nntp to get to news.gmane.org, not email, so I
believe the problem is with gmane, but this is just a guess.

Nick


It was and just gmane, but also email and the "official" org mail list

Charlie Millar

P.S. Not sure if you have seen my post about this issue that I added to 
the bug latex exporter thread

Re: [O] Showing DONE tasks in agenda?

[Nick Dokos]

Peter Davis  writes:

> Eric S Fraga  writes:
>
>> On Wednesday, 30 Sep 2015 at 12:13, Peter Davis wrote:
>>> When I display my TODO items (with C-c a t), there's a line at the top
>>> of the buffer that says:
>>>
>>> Available with `N r': (0)[ALL] (1)TODO (2)DONE
>>>
>>> but I don't know what this means. How can I display all (TODO, DONE,
>>> whatever) items?
>>>
>>> Typing 'N r' in the buffer doesn't do it.
>>
>> I think the N refers to the numeric choice (0, 1 or 2).  Have you tried,
>> for instance, typing "2 r"?
>
> Ah! Thank you, Eric. That seems to explain it, except ...
>
> '0 r' and '1 r' both show the same thing ... just TODO items. '2 r'
> shows me just DONE items, so none of the options shows both TODO
> and DONE items.
>

That's because you only have a TODO|DONE state sequence. I have a few more:

,
| org-todo-keywords-for-agenda is a variable defined in ‘org.el’.
| Its value is ("APPT" "DONE" "TODO" "CANCELLED")
`

I believe that value was constructed by org, because I have the
following #+TODO: lines in (one or another of) my agenda files:

#+TODO: APPT | DONE

#+TODO: TODO | DONE CANCELLED


APPT and TODO are on the left of the '|' - DONE and CANCELLED are
on the right. See

   (info "(org) Workflow states")

for the meaning of  "left and right of '|'".

So when I do ``C-c a t'' I get:

,
| Available with ‘N r’: (0)[ALL] (1)APPT (2)DONE (3)TODO (4)CANCELLED
`

0 r gives me all APPT and TODO (N.B.: you still only get the left-of-'|'
states)
1 r gives me APPT
3 r gives me TODO
2 r gives me DONE
4 r gives me CANCELLED

AFAIK, there is no way to get both the left-of-'|' *and* the
right-of-'|' states in one display, unless maybe you write your
own view (which I have not done, and I don't know if it's
easy/difficult/impossible).

Nick

Re: [O] Delays in posting

[Thomas S . Dye]

Hi Nick,

Nick Dokos  writes:

> This is just an FYI.
>
> Over the past couple of days, I've noticed delays in posting.
> I posted a couple of things two days ago that didn't show up
> until one day later. I believe a couple of other people have
> noticed the same thing. I figured that since the posts *did*
> show up, the problems were resolved, but another post from this
> morning still hasn't shown up four hours later.
>
> I use Gnus/nntp to get to news.gmane.org, not email, so I
> believe the problem is with gmane, but this is just a guess.

I read the emacs-orgmode list and have noticed the same thing.

All the best,
Tom

-- 
Thomas S. Dye
http://www.tsdye.com

Re: [O] Delays in posting

[Dave Marquardt]

Nick Dokos  writes:
> Over the past couple of days, I've noticed delays in posting.
> I posted a couple of things two days ago that didn't show up
> until one day later. I believe a couple of other people have
> noticed the same thing. I figured that since the posts *did*
> show up, the problems were resolved, but another post from this
> morning still hasn't shown up four hours later.
>
> I use Gnus/nntp to get to news.gmane.org, not email, so I
> believe the problem is with gmane, but this is just a guess.

I'm seeing the same thing.

-Dave

Re: [O] Bug: Error on preview of latex equation [8.3.2 (release_8.3.2-138-g679adc @ /Users/rainerkrug/.emacs.d/org-mode/lisp/)]

[Nicolas Goaziou]

Hello,

Rainer M Krug  writes:

> Sometimes after wo=rking in a document with many latex formulas I get,
> when trying to preview a new formula I get the folowing error:
>
> ,
> | org-remove-if: Wrong type argument: number-or-marker-p, nil
> `

Fixed, hopefully.


Regards,

-- 
Nicolas Goaziou

[O] BUG: emacs orgmode ob-R.el function org-babel-R-evaluate-session over aggressively performs "; ; cleanup extra prompts left in output" and a possible workaround

[Cook, Malcolm]

Hello ,

I am not sure what the best solution is, but, in my hands using Org-mode 
version 8.3.2-elpa org-20150929 the reg-expt  used to "cleanup extra prompts 
left in output" is over-aggressive and will trim session :output at lines 
consisting exclusively of blanks and periods such as produced when printing a 
BioConductor 'Views' object which wants to appear as

#+RESULTS:
#+begin_example
  Views on a 23011544-letter DNAString subject
subject: 
CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCACTCTCCCATATTATAGGGAGAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTTTGATTGGCAACCCTGGTGGCGGATGAACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCATTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATA...TATCTTTCAAAGATGACACTAGCAATGCGTTAACCCAAATAATGATTTCCCTAAATCCTTCCGTAAATATTAACTGGCTCCACCCAAATTTCGGTCATTAAATAATCAGTTGCCACAACTAATTGTCTGTGGAATGTCATATCTCGATGAGCTCATAATTAAATTTACAATCAAACTGTGTTCGAGAGCTAACATTTGGCATATTTGCAAAGATGAACCTTTCAAA
views:
 start  end width
  [1]   344766   344773 8 [CATGAGGC]
  [2]   563564   563571 8 [CATGAGGC]
  [3]   641027   641034 8 [CATGAGGC]
  [4]   656168   656175 8 [CATGAGGC]
  [5]   709112   709119 8 [CATGAGGC]
  ...  ...  ...   ... ...
[141] 22209984 22209991 8 [CATGAGGC]
[142] 22371543 22371550 8 [CATGAGGC]
[143] 22554991 22554998 8 [CATGAGGC]
[144] 22618578 22618585 8 [CATGAGGC]
[145] 22897728 22897735 8 [CATGAGGC]
#+end_example

But alas rather appears as:

#+RESULTS:
#+begin_example
  ...  ...  ...   ... ...
[141] 22209984 22209991 8 [CATGAGGC]
[142] 22371543 22371550 8 [CATGAGGC]
[143] 22554991 22554998 8 [CATGAGGC]
[144] 22618578 22618585 8 [CATGAGGC]
[145] 22897728 22897735 8 [CATGAGGC]
#+end_example


I offer as a possible workaround the following:

So far, I have had good success having removed provision for allowing leading 
whitespace by changing the regexp  org-babel-R-evaluate-session  from
  "^\\([ ]*[>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"
 to
  "^\\([>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"

But I don't know all the test cases so, YMMV

HTH,

~Malcolm (who, FWIW, has never really liked the way ob-R communicated with the 
inferior R session in the first place)

Re: [O] org export outcomes differ from one attempt to the next

[Nicolas Goaziou]

Eric S Fraga  writes:

> I wish I could provide more insight into the problem but, at least for
> now, I am able to get my ~700 slides ready for teaching this term!  My
> gut feeling, nonetheless, is that I have something in one of the 700
> slides that confuses the org parser somehow so that by the time the end
> of the file is reached, some data structures are inconsistent.  But who
> knows?

It doesn't ring a bell. Wild guess: what if you set
`org-element-use-cache' to nil prior to export?

Regards,

Re: [O] undefined symbol 'org-export-create-backend' when calling org-plot/gnuplot

[Nicolas Goaziou]

Hello,

Dave Marquardt  writes:

> I did git bisect on a couple of x86_64 Linux systems:
> - RHEL 6.7 with Emacs 24.3.2
> - Fedora 22 with Emacs 24.5.1
>
> The result was
>
> # first bad commit: [6d2ab4071960f8a7f20138291424b468722ab522] org-table: Fix 
> radio tables containing macros
>
> The table I ran M=x org-plot/gnuplot on was from the Org Mode info page
> "Org-Plot":
>
>  #+PLOT: title:"Citas" ind:1 deps:(3) type:2d with:histograms set:"yrange 
> [0:]"
>  | Sede  | Max cites | H-index |
>  |---+---+-|
>  | Chile |257.72 |   21.39 |
>  | Leeds |165.77 |   19.68 |
>  | Sao Paolo | 71.00 |   11.50 |
>  | Stockholm |134.19 |   14.33 |
>  | Morelia   |257.56 |   17.67 |
>
> Stack backtrace is as mentioned earlier:
>
> Debugger entered--Lisp error: (void-function org-export-create-backend)

Fixed. Thank you.

Regards,

-- 
Nicolas Goaziou

Re: [O] org-adapt-indentation

[Thomas S . Dye]

Thanks!

All the best,
Tom

Nicolas Goaziou  writes:

> Hello,
>
> Thomas S. Dye  writes:
>
>> Is the indentation performed when this variable is non-nil
>> cosmetic, or does it have an effect on Org mode processes such as
>> export, etc.?
>
> I don't think so.
>
>
> Regards,

-- 
Thomas S. Dye
http://www.tsdye.com

Re: [O] undefined symbol 'org-export-create-backend' when calling org-plot/gnuplot

[Dave Marquardt]

Nicolas Goaziou  writes:

> Hello,
>
> Dave Marquardt  writes:
>
>> I did git bisect on a couple of x86_64 Linux systems:
>> - RHEL 6.7 with Emacs 24.3.2
>> - Fedora 22 with Emacs 24.5.1
>>
>> The result was
>>
>> # first bad commit: [6d2ab4071960f8a7f20138291424b468722ab522] org-table: 
>> Fix radio tables containing macros
>>
>> The table I ran M=x org-plot/gnuplot on was from the Org Mode info page
>> "Org-Plot":
>>
>>  #+PLOT: title:"Citas" ind:1 deps:(3) type:2d with:histograms 
>> set:"yrange [0:]"
>>  | Sede  | Max cites | H-index |
>>  |---+---+-|
>>  | Chile |257.72 |   21.39 |
>>  | Leeds |165.77 |   19.68 |
>>  | Sao Paolo | 71.00 |   11.50 |
>>  | Stockholm |134.19 |   14.33 |
>>  | Morelia   |257.56 |   17.67 |
>>
>> Stack backtrace is as mentioned earlier:
>>
>> Debugger entered--Lisp error: (void-function org-export-create-backend)
>
> Fixed. Thank you.

I've verified that this is fixed. Thanks!

-Dave

Re: [O] Different set of packages for LaTeX export

[Rasmus]

Hi Manfred,

Manfred Lotz  writes:

> When creating slides, i.e using beamer I get an option clash
> during compiling the tex file because beamer did already load hyperref.
>
> How can I solve it? 
>
> Could I have a different package list if the class is beamer?

No you can only discriminate based on the compiler version (and actually
only in ox-latex, not ox-beamer).

You can use a filter to remove hyperref.  AFAIK, there's only issues if
you use funny options for hyperref, e.g. I use

("unicode, psdextra,hidelinks" "hyperref" nil).

Last I checked there was an open bug report for this, so it might have
been fixed in upstream beamer.

I use this filter to remove hyperref in beamer exports:

   (defun rasmus/org-beamer-filter-remove-hyperref (text backend info)
 "Remove hyperref from beamer tex files.

 My default values are incompatible with beamer."
 ;; TODO: make better solution; check if still necessary
 (when (org-export-derived-backend-p backend 'beamer)
   (replace-regexp-in-string
"usepackage\\[\\(.*?\\)\\]{hyperref}\n"
""
text)))

   (add-to-list 'org-export-filter-final-output-functions
'rasmus/org-beamer-filter-remove-hyperref)


Hope it helps,
Rasmus

-- 
Slowly unravels in a ball of yarn and the devil collects it

Re: [O] org-adapt-indentation

[Nicolas Goaziou]

Hello,

Thomas S. Dye  writes:

> Is the indentation performed when this variable is non-nil
> cosmetic, or does it have an effect on Org mode processes such as
> export, etc.?

I don't think so.


Regards,

-- 
Nicolas Goaziou

Re: [O] BUG: emacs orgmode ob-R.el function org-babel-R-evaluate-session over aggressively performs "; ; cleanup extra prompts left in output" and a possible workaround

[Charles C. Berry]

On Thu, 1 Oct 2015, Cook, Malcolm wrote:


Hello ,



I am not sure what the best solution is, but, in my hands using Org-mode 
version 8.3.2-elpa org-20150929 the reg-expt used to "cleanup extra 
prompts left in output" is over-aggressive and will trim session :output 
at lines consisting exclusively of blanks and periods such as produced 
when printing a BioConductor 'Views' object which wants to appear as


I'd try (for example):

#+BEGIN_SRC R :results value raw drawer :session
require(GenomicRanges)
capture.output(show(GRanges(seqnames=rep("a",100),
IRanges(start=1:100,width=1),strand=rep("*",100
#+END_SRC

rather than messing with the regexp.




I offer as a possible workaround the following:

So far, I have had good success having removed provision for allowing leading 
whitespace by changing the regexp  org-babel-R-evaluate-session  from
 "^\\([ ]*[>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"
to
 "^\\([>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"

But I don't know all the test cases so, YMMV


Just guessing that the things that `(setq ess-eval-visibly nil)' generates 
(e.g., + + + + + > ) won't behave using your version.


HTH,

Chuck

Re: [O] BUG: emacs orgmode ob-R.el function org-babel-R-evaluate-session over aggressively performs "; ; cleanup extra prompts left in output" and a possible workaround

[Cook, Malcolm]

> > I am not sure what the best solution is, but, in my hands using
 > > Org-mode version 8.3.2-elpa org-20150929 the reg-expt used to "cleanup
 > > extra prompts left in output" is over-aggressive and will trim session
 > > :output at lines consisting exclusively of blanks and periods such as
 > > produced when printing a BioConductor 'Views' object which wants to
 > > appear as
 > 
 > I'd try (for example):
 > 
 > #+BEGIN_SRC R :results value raw drawer :session
 > require(GenomicRanges)
 > capture.output(show(GRanges(seqnames=rep("a",100),
 >  IRanges(start=1:100,width=1),strand=rep("*",100
 > #+END_SRC

Thanks for the thought, but, I'm trying to engage in "literate programming" for 
which in my opinion I should not have to re-write my code (using capture.output 
and show) to get the output of evaluation captured.

We're I to sweave my code I would get all this un-wanted cruft.

I think org-bable-R-evaluate-FOO should be handling all this for us.

 > rather than messing with the regexp.

Hmm not sure I understand your preference here.   I'm providing an example 
of some that should "just work", but does not.   I too prefer not to mess with 
the regexp other than to identify it as the source of the issue.  Perhaps the 
"real solution" is to recode org-bable-R-evaluate-FOO.

> > I offer as a possible workaround the following:
 > >
 > > So far, I have had good success having removed provision for allowing
 > leading whitespace by changing the regexp  org-babel-R-evaluate-session
 > from
 > >  "^\\([ ]*[>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"
 > > to
 > >  "^\\([>+\\.][ ]?\\)+\\([[0-9]+\\|[ ]\\)"
 > >
 > > But I don't know all the test cases so, YMMV
 > 
 > Just guessing that the things that `(setq ess-eval-visibly nil)' generates 
 > (e.g., +
 > + + + + > ) won't behave using your version.
 > 

In fact it does behave.  I tried it.  I think that ess-eval-visibly effects how 
ob-R interacts with the ess session.

 > HTH,

I wish it did ;)  Thanks for your efforts.

 > 
 > Chuck

Re: [O] [PATCH] Substitute a guid XML element in org-feed

[Nicolas Goaziou]

Hello,

Hiroshi Saito  writes:

> A guid XML element is not substituted in org-feed. Here is a patch to
> fix it.

Applied. Thank you.

Regards,

-- 
Nicolas Goaziou

Re: [O] [PATCH] Reverse capture finalize and refile, hack buffer killing.

[Nicolas Goaziou]

Hello,

Jan Seeger  writes:

> * org-capture.el (org-capture-refile): Call finalize first, then
>   refile. If the capture buffer needs to be killed afterwards, kill
>   after refiling.

Thank you.

For some reason, I cannot apply it on maint branch. Could you send it
again as an attachment ?

Thank you.

Regards,

-- 
Nicolas Goaziou

[O] org-mode YouTrack integration?

[Peter Davis]

I see that some folks have done org-mode/Jira integration work. which 
looks really useful. As it turns out, though, my team (with no other 
emacs users) is now weighing switching to JetBrains' YouTrack.


Has anyone done an integration with that? Or even started to?

Thanks!
-pd

Re: [O] Define org-capture-templates with variables via customize

[Nicolas Girard]

2015-04-04 23:54 GMT+02:00 Xavier Maillard :
>
>
> Ok, sounds like there is something I can /hack/ to permit such thing
> then.
>
> Update: I finally got it running as I wanted to through an ugly hack.
>

Hi Xavier,

could you please elaborate a bit on your hack ?

Thanks in advance,

Nicolas

Re: [O] Showing DONE tasks in agenda?

[Peter Davis]

On 10/1/15 2:16 PM, Nick Dokos wrote:

Peter Davis  writes:


Eric S Fraga  writes:


On Wednesday, 30 Sep 2015 at 12:13, Peter Davis wrote:

When I display my TODO items (with C-c a t), there's a line at the top
of the buffer that says:

Available with `N r': (0)[ALL] (1)TODO (2)DONE

but I don't know what this means. How can I display all (TODO, DONE,
whatever) items?

Typing 'N r' in the buffer doesn't do it.

I think the N refers to the numeric choice (0, 1 or 2).  Have you tried,
for instance, typing "2 r"?

Ah! Thank you, Eric. That seems to explain it, except ...

'0 r' and '1 r' both show the same thing ... just TODO items. '2 r'
shows me just DONE items, so none of the options shows both TODO
and DONE items.


That's because you only have a TODO|DONE state sequence. I have a few more:

,
| org-todo-keywords-for-agenda is a variable defined in ‘org.el’.
| Its value is ("APPT" "DONE" "TODO" "CANCELLED")
`

I believe that value was constructed by org, because I have the
following #+TODO: lines in (one or another of) my agenda files:

#+TODO: APPT | DONE

#+TODO: TODO | DONE CANCELLED


APPT and TODO are on the left of the '|' - DONE and CANCELLED are
on the right. See

(info "(org) Workflow states")

for the meaning of  "left and right of '|'".

So when I do ``C-c a t'' I get:

,
| Available with ‘N r’: (0)[ALL] (1)APPT (2)DONE (3)TODO (4)CANCELLED
`

0 r gives me all APPT and TODO (N.B.: you still only get the left-of-'|'
 states)
1 r gives me APPT
3 r gives me TODO
2 r gives me DONE
4 r gives me CANCELLED

AFAIK, there is no way to get both the left-of-'|' *and* the
right-of-'|' states in one display, unless maybe you write your
own view (which I have not done, and I don't know if it's
easy/difficult/impossible).


Great! Thanks, Nick. This clears up a lot.

-pd

--

Peter Davis
The Tech Curmudgeon
www.techcurmudgeon.com

Re: [O] Different set of packages for LaTeX export

[Manfred Lotz]

On Thu, 01 Oct 2015 21:21:42 +0200
Rasmus  wrote:

> Hi Manfred,
> 
> Manfred Lotz  writes:
> 
> > When creating slides, i.e using beamer I get an option clash
> > during compiling the tex file because beamer did already load
> > hyperref.
> >
> > How can I solve it? 
> >
> > Could I have a different package list if the class is beamer?
> 
> No you can only discriminate based on the compiler version (and
> actually only in ox-latex, not ox-beamer).
> 

Hm, I think it would be great if a package list could be mapped to a
certain LaTeX class.

> You can use a filter to remove hyperref.  AFAIK, there's only issues
> if you use funny options for hyperref, e.g. I use
> 
> ("unicode, psdextra,hidelinks" "hyperref" nil).
> 

I have this 
  ("colorlinks=true, urlcolor=FireBrick, plainpages=false,
pdfpagelabels, bookmarksnumbered" "hyperref" nil)

which IMHO doesn't look to exotic.


> Last I checked there was an open bug report for this, so it might have
> been fixed in upstream beamer.
> 
> I use this filter to remove hyperref in beamer exports:
> 
>(defun rasmus/org-beamer-filter-remove-hyperref (text backend
> info) "Remove hyperref from beamer tex files.
> 
>  My default values are incompatible with beamer."
>  ;; TODO: make better solution; check if still necessary
>  (when (org-export-derived-backend-p backend 'beamer)
>(replace-regexp-in-string
> "usepackage\\[\\(.*?\\)\\]{hyperref}\n"
> ""
> text)))
> 
>(add-to-list 'org-export-filter-final-output-functions
> 'rasmus/org-beamer-filter-remove-hyperref)
> 
> 

Yep, this works fine.


Thanks a lot for your help.

-- 
Best, Manfred

Re: [O] Different set of packages for LaTeX export

[Fabrice Popineau]

2015-10-02 5:30 GMT+02:00 Manfred Lotz :

> On Thu, 01 Oct 2015 21:21:42 +0200
> Rasmus  wrote:
>
> > Hi Manfred,
> >
> > Manfred Lotz  writes:
> >
> > > When creating slides, i.e using beamer I get an option clash
> > > during compiling the tex file because beamer did already load
> > > hyperref.
> > >
> > > How can I solve it?
> > >
> > > Could I have a different package list if the class is beamer?
> >
> > No you can only discriminate based on the compiler version (and
> > actually only in ox-latex, not ox-beamer).
> >
>
> Hm, I think it would be great if a package list could be mapped to a
> certain LaTeX class.
>
>
To solve this, I set up my own LaTeX class. I find it at least as good as
to rely
on Org configuration. Actually, I removed the list of packages that Org is
exporting.
My LaTeX class can produce slides, course notes, exams and so on. Based on
options, I can chose which kind of document and a few things like the style
(font, etc.).

Fabrice