Re: What if computation is unrepeatable?
On Mon, Jul 11, 2005 at 05:27:33PM -0400, Jesse Mazer wrote: I don't know what compiler optimization flags are, but if the trajectories Compiler optimization flags tell the compiler to optimize generated code more aggressively, which may even break your code, at a high optimization setting. Anything involving changing order of instruction execution and not using accurate arithmetics (FPU floats) will introduce numerical error, which will result in an exponential deviation in a susceptible system. This is not a problem (unless the result fails to converge) as higher order metrics are extracted from the raw trajectory in a numerical experiment. This is entirely equivalent to injecting a small amount of numerical noise into the system, or perturbing a nonlinear system (such as a neuronal network in vivo). are different, presumably that means that you are not really running exactly the same algorithm, if you include the compiler as part of the whole algorithm (ie if you wanted to emulate what the computer is doing Absolutely, the code generated is different. It's not the same algorithm. This is something which can trap the naive user, however, and it makes regression testing (which looks for precise end result in a number of test cases) quite more difficult. Similiar issues occur with execution errors (a bit flipped in processing, undetected), and parallel algorithms which optimize performance for accuracy (e.g. using a protocol on the signalling mesh which won't detect a dropped packet). Such issues are becoming more and more pronounced with the length of the run (total number of instructions) and the size of the parallel system, ultimatively resulting in a degree of unreliability e.g. in computer proofs. Physical simulations are more robust here. using a universal Turing machine, the input strings would have to be different for different compilers). Yes. However, the reality makes the term a specific algorithm somewhat blurry, and more difficult to measure. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Mon, Jul 11, 2005 at 10:38:35PM -0700, George Levy wrote: Stathis Papaioannou wrote: The ionic gradients across cell membranes determine the transmembrane potential and how close the neuron is to the voltage threshold which will trigger an action potential by opening transmembrane ion Stop your heart now. See EEG collapse to zero in 20-30 sec. Your transient gradients (spikes) are gone with the oxygen, until circulation is restored. All you see is a brief blackout. I wonder for whom I'm writing all these mails. channels. Other factors influencing this include the exact geometry of the neuron and composition of the cell membrane (which determines capacitance and the shape and speed of propagation of the action potential), the number, type and location of voltage-activated ion channels, the number, type and location of various neurotransmitter receptors, the local concentration of enzymes that break down neurotransmitters, and many other things besides. The ionic gradients You might be surprised: http://www.google.com/search?hl=enq=computational+neurosciencebtnG=Google+Search across cell membranes (all cell membranes, not just neurons) are actively maintained within tight limits by energy-requiring transmembrane proteins, such as Na/K ATPase, and if this suddenly stops working, the cell will quickly die. The moment to moment Define quickly. You can culture human neurons for several days after death. At deep hypothermia and flushout, the empirical canine viability window is several hours (the ceiling could be at 12 h or more, nobody knows yet). http://groups.yahoo.com/group/transhumantech/message/29582 variations in ion fluxes and membrane potential may be allowed to collapse and the neuron will remain structurally intact, so to this extent the exact cellular chemistry may not be necessary for long term You can safely remove the conditional here. memories. However, all the other things I have mentioned are important in determining the wiring diagram and strength of connections, and could easily be maintained over decades. Look up action potential in Yes, and all of them seem to be present in vitrified brain tissue -- a snapshot with geological shelf half-life. Wikipedia, and think about how you would design an equivalent circuit for even one neuron. It may be a ridiculously complex way to design a You don't design a circuit for a specific neuron. That would be moot, as a circuit is fixed, and a neuron is not (an understatement: see cell migration in neuromorphogenesis). What you need is a computational engine capable of emulating arbitrary cells in the CNS. The hardware layer of such a system can be very simple, the complexity being contained in several emulation layers. computer that would be able to run and maintain a human body, but whereas I would happily trade my heart or my kidneys for more efficiently engineered models, I would like any brain replacement to be an exact functional analogue of my present one. Nobody is trying to sell anything else. Stathis, you don't have to get down to that level of complexity. As long as the high level function remains the same, you can still say yes doctor to a substitution experiment. Example: artificial eye lenses made of plastic and not of tissue, prostheses made of titanium steel and not of bone. I seem to not be coming through, so this will be the last post on my part in this thread, for a long while. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: The Time Deniers
On Mon, Jul 11, 2005 at 03:48:48PM +1000, Stathis Papaioannou wrote: (c) A random string of binary code is run on a computer. There exists a programming language which, when a program is written in this language so that it is the same program as in (a) and (b), then compiled, the binary code so produced is the same as this random string. Is this nonsense? Is (c) fundamentally different from (b)? If not, doesn't it mean that any random string implements any program? We might not know what it says, but if the program is self-aware, then by definition *it* knows. The space of all binary strings is vastly larger than the space of strings constituting a valid program, and the space of aware (AI) programs is again a tiny subset. It's a pretty sterile (and very rugged) fitness landscape. The probability of finding a nontrivial program by pure chance is about the same as a pebble in Gobi hopping through a fluke in Brownian noise. (More abstract machines can be more forgiving, in regards of what is well-formed). -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Mon, Jul 11, 2005 at 10:31:56AM +1000, Stathis Papaioannou wrote: Perhaps, perhaps not. For one thing, in the brain's case we are relying on the laws of chemistry and physics, which in the real world are invariable; we don't know what would happen if these laws were slightly off in a A systematic error or noise beyond the homeostatic capability of the simulation would generate nonsense, of course. So, stay below the error threshold. simulation. For another, we do know that tiny chemical changes, such as a few molecules of LSD, can make huge behavioural changes, suggesting that the brain is exquisitely sensitive to at least some parameters. It is So, don't put LSD in the simulated brain. Don't zap the CMOS junction with electrostatics. Don't put the system nearby a Co-60 source. Do not mutate bits randomly. Do not change the meaning of a primitive randomly every few ticks. If it hurts, don't do it. likely that multiple error correction and negative feedback systems are in place to ensure that small changes are not chaotically amplified to cause gross mental changes after a few seconds, and all these systems would have to be simulated as well. The end result may be that none of the cellular Of course. And your point is? machinery can be safely ignored in an emulation, which is very far from modelling the brain as a neural net. I may be wrong, and it may be simpler Strawman, again. than I suggest, but as a general rule, if there were a simpler and more economical way to do things, evolution would have found it. Biological tissues are not evolved to e.g. work with EM radio, or electron spin for information processing, or nuclear fission for power sources, or an enzyme to deposit diamond. Regardless how many gigayears you spend evolving, this will never be discovered due to kinetic blocks, fitness crevices, and sterile areas in fitness space which can't be crossed incrementally. Human design doesn't have that limitation. We can in principle do whatever evolution can do (by explicitly invoking the process, in an accelerated model), and more. The fitness function of discrete information processing in solid state is entirely different from CNS. Most of what the genome does is not devoted to neural information processing, and, frankly anisotropically excitable nonlinear medium is a control paradigm from hell. There are simpler and more economical ways to do things, and we'll be there in about 20-30 years. Meanwhile, biology reigns supreme in crunch/Joule, integration density, error tolerance and a few other things, but we're gaining on it rapidly. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: What if computation is unrepeatable?
On Mon, Jul 11, 2005 at 04:45:21PM -0400, Jesse Mazer wrote: I don't think that paper is talking about computations being nonrepeatable--they say that they're not talking about stochastic variations (which I think refers to genuine physical sources of randomness), but instead about some type of deterministic chaos. Since it's deterministic, presumably that means if you feed exactly the same input to exactly the same program it will give the same results, the sensibility to It is quite common that even different compiler optimization flags (nevermind different architectures) result in very different trajectories in numerical simulation (e.g. MD is very susceptible to a nonlinear/butterfly effect). initial conditions probably just means if you change a single bit in the input the output will be very different, something along those lines. And when they say the performance is variable, I think they're talking about some measure of performance during a single execution of a given program, not about repeating the execution of the same program multiple times and finding variations from one run to another. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Sun, Jul 10, 2005 at 11:49:53PM +1000, Stathis Papaioannou wrote: 3) Combining General and Particular Architectures Fusing information to combine apriori knowledge of general architecture brain functions, and particular architecture data obtained from in situ functional measurements (e.g. fMRI), neurological and psychological measurements, as well as self-analysis, it may be possible to reconstruct a functional copy of the brain close enough as to be indinstinguishable from the original by the owner. How does the owner knows it is indistinguishable? This is a whole topic. He could for example do a series of partial substitutions to find out if it feels the same or not. For example, he could substitute in sequence the visual cortex, the auditory cortex, some of the motor functions We may be closer to this goal than you think. OK, I agree it is possible, and I'm glad nobody is insisting that just the arrangement of neurons and their connections, such as could in theory have been determined by a 19th century histologist, is enough information to Exactly; it's a strawman position. Nobody claims a 5 m resolution satellite photo shows you what brands of pizza that shop on the corner is selling. emulate a brain. I think we would need to have scanning resolution close to the atomic level, and very detailed modelling of the behaviour of cellular subsystems and components down to the same level. I don't know how long it You need this level of detail only initially, to obtain empiric system parameters for an abstracted system level. You might want to reach down to ab initio level of theory, to obtain missing parameters for an MD simulation, to obtain switching behaviour of an ion channel, depending on modification, to obtain computational behaviour of a piece of dendrite (of course, you can also obtain that empirically from e.g. voltage-sensitive dye/patch-clamping). Even then, the actual simulation unit could be a few layers up, at abstract neocortex columns, or similiar. In the end, you have to destructively scan an animal to obtain your very large set of numbers, to enter into your simulation. Transiently, that disassembly might involve sampling some voxels at a high level of resolution, very possibly submolecular. That level of detail might be present in the voxel buffer, transiently, before being processed by algorithms, and destilled into a much smaller set of small integers. would take to achieve this, but I know that we are nowhere near it now. For example, consider our understanding of schizophrenia, an illness which If we had fully functional (discrete, fully introspective, traceable) models of individuals having schizophrenia, and controls, finding structural and functional deficits resulting in the phenotype would be effectively trivial. drastically changes almost every aspect of cognition. For half a century we have had drugs which ameliorate the psychotic symptoms patients with this illness experience, and we have been able to determine which receptors these drugs target. But despite decades of research, we still have no idea what the basic defect in schizophrenia is, how the drugs work, or any We don't have methods with sufficient resolution, that's all. clinically useful investigation which helps with diagnosis. Although fMRI and PET scans can show differences in cerebral blood flow compared to fMRI has voxel sizes at several mm^3, and temporal resolution of seconds. MRI microscopy does much better, but only works on insect/mouse-sized samples. Nondestructive methods do not scale into the volume. control subjects, this is a secondary effect. The brains of schizophrenia sufferers, looked at with any tools available to us, are essentially the same as normal brains. In other words, a very subtle, at present undetectable, change in the brains of these patients can cause gross cognitive and behavioural changes. http://www.google.com/search?num=100hl=enlr=safe=offclient=firefox-arls=org.mozilla%3Aen-US%3Aofficialq=molecular+schizophreniabtnG=Search would seem to disagree. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Thu, Jul 07, 2005 at 04:51:23PM +1000, Stathis Papaioannou wrote: I have no problem with the idea that everything about a person's personality, memories etc. is physically encoded in his brain, and that in principle, sufficiently detailed knowledge about his brain should allow an emulation on a computer which would be just like the original person. The Fair enough. You seem to suddenly deviate from this position at some point below, though. problems are: (1) what is the level of detail of neuronal information required; It doesn't matter, if that information is present in the vitrified brain. Preliminary results look good http://leitl.org/docs/cryo/ More results will be forthcoming in the next 1-2 years (this is something I know, not guess). (2) can this requisite information be preserved in a post-mortem specimen; See above. No showstoppers, under optimal conditions. (3) can the information be scanned or read in a way that can be used in a computer model; Yes, though TEM is probably not sufficient. Scaled up cryo AFM has more than enough resolution, and allows individual sampling of ablated molecules. In times where CO molecules are individually sorted by the isotopes by numerical control, and assembled into elaborate circuits, this shouldn't require much faith. (4) can each subsystem of neuronal function relevant to cognition be modelled closely enough to allow emulation; This is the most difficult point: you have to build a system which can abstract models, building at least 2-3 hierarchies, until you arrive at an isofunctional model well mapped to the hardware used. I have ideas in that direction, but nothing has been tested yet. (5) given adequate information and adequate models, is the computer power available up to the task of emulation in anything like real time? Near future will give us systems built from moles of bits (by self-assembly of individual molecular circuits). Pretty speedy systems, enough for a speedup of 10^6, if not more. The difficulty lies in obtaining a model which is isofunctional to the original. By the time you have that model, hardware will not be a bottleneck. I believe the level of detail required and the complexity of the required models is grossly underestimated. Simply getting a 3D image of a brain down No offense, but given the level of your ignorance, how do you know who has estimated what? to electron microscopic detail, including all the synaptic connections, would be an enormous task, and it probabaly wouldn't tell us any more about Yes. You need more resolution than TEM, btw. That's what automation is for. the mind of the brain's owner than a picture of the books on a library shelf would tell us about the book contents. I would bet more on mediaeval I told you we have results that there's probably enough preserved for the tissue to be retransplantable(!). Once it's in the dewar, time stops. I told you we have current methods allowing you to resolve submolecular structures in cryopreserved tissue. There's no fundamental reason why you can't image kg-sized vitrified objects at atomic resolution, at least transiently where it matters (what is this transmembrane protein, and how is it been modified, the membrane itself is rather boring). This is easily verified even with only online information. The information is preserved in the structure. Are you claiming that there is something missing? What, precisely, then? monks decoding the data on a DVD sent back in time than I would bet on scientists decoding the contents of a human mind from cryopreserved brain sections. You'll see individually accurate numerical models of simple critters + virtual models within the 20-30 year time frame. We could do this now with C. elegans, given 5-10 years, and a considerable budget. If mind uploads were to become a reality, I think the best strategy would be research into brain-computer interfacing. What is your estimated time frame for advent of technology like http://nanomedicine.com/ I, personally, am not holding my breath. YMMV. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Thu, Jul 07, 2005 at 12:49:07PM +1000, Stathis Papaioannou wrote: The high standard I have described does not go nearly as far as copying the exact quantum state of every atom. It is merely aknowledging the fact Two systems in the same quantum state being indistinguishable is only relevant for equilibrium constants and gedanken experiments. that information in brains is not stored in the anatomical arrangement of neurons, any more than data on a computer is stored in the computer's circuit diagram. If you copy a car down to the scale of a fraction of a millimetrel you can expect that the copy will work the same as the original, but if you copy a computer down to the sub-micron level you might end up with a machine that will run Windows XP or whatever, but you won't copy the data in RAM or on the hard drive. While it is not known exactly Okay, your objection is simply not enough resolution. I agree. TEM is not enough resolution by far. how information is stored in a brain, it is certainly dependent on such parameters as ionic gradients across cell membranes and the type, number, No, that's wrong. Gradients collapse (you see them collapsing on the EEG in realtime) after 20-30 sec of stopped blood flow, even at normothermic ischaemia (even without hypothermia and drugs (barbiturates, etc)). distribution and conformation of receptor and ion channel proteins. At its Yes, and quite a few other things. simplest, the brain could be seen as using a binary code, each neuron having two possible states, on or off. However, a snapshot of the state of each neuron will not allow a model of the brain to be built, because all the anciliary cellular machinery as above is needed to work out how to get from one state to the next. If it were otherwise, why would all this complexity have evolved? I do not understand your objections here. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: where do copies come from?
On Wed, Jul 06, 2005 at 10:31:50PM +1000, Stathis Papaioannou wrote: This may be getting a little off topic for this list, but it has always seemed to me hopelessly naive to think that a person's mind could be Perhaps, perhaps not. emulated from cryopreserved brain tissue. It would be like trying to recreate a telephone conversation by examining a diagram of a city's telephone network. Even if you could get the anatomy correct, which would This is not a correct analogy. Individual spike trains are readily regenerated from a neuron circuit. Neurons are not people on the telephone. There's nobody using your telephone network above but whatever intrinsic activity there is in the network itself. mean knowing every neuron's connection with every other neuron, you would Of course. Empirically, submolecular resolution is available (cryo AFM). Whether it is going to be needed (say, to read the degree of phosphorylation of a protein, or identify individual ion channel type) is another question. The information is there, and we can almost access it with current technology (completely ignoring scaling up issues). have nowhere near enough information to model a human brain, let alone a particular human brain state at the time of death. You would also need to Which information you think would be missing? know the electrical potential at every point of every cell membrane; the ionic gradients (Na, K, Ca, pH and others) across every cell membrane, including intracellular membranes; the type, position and conformation of every receptor, ion channel and other proteins; the intracellular and local extracellular concentrations of every neurotransmitter; the workings of the cellular transport, synthetic and repair mechanisms for each neuron and probably also for each supporting glial cell; the intracellular and extracellular concentration of other small molecules such as glucose, O2, CO2; how all of this is changing with respect to time; and probably thousands of other paramemters, many of which would currently be unknown. We empirically know that individual animal or human pattern can resume from zero electrochemical activity and about zero metabolic activity (few degrees above 0 C). We also have evidence (not fully validated yet) that vitrified retransplanted (renal, so far) tissue is viable. Taken together it strongly hints that there is enough information, and that most of above factors cited are empirically incorrect. You don't need them. There might be showstoppers yet, but current trends are good. Some publications are in the pipeline, hang on for a year or two. Most of this information would probably be lost post-mortem, but even if some process could be found that preserves it, the sort of technology needed to scan a brain at this sort of detail would probably not be far short of atom for atom matter duplication and teleportation. You cannot scan a living cephalon without invading it with several liters of active nanomachinery. Most likely, no such machinery will be available within our lifetime. Because of this I'm focusing on cryopreserved people. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: More is Better (was RE: another puzzle)
On Thu, Jun 30, 2005 at 04:25:09PM -0700, Lee Corbin wrote: I've sometimes wondered whether some anaesthetics might work this way: put you into a state of paralysis, and affect your short term memory. So you actually experience the doctor cutting you open, with all the concommitant pain, but you can't report it at the time and forget about it afterwards. If you knew an anaesthetic worked that way, would you agree to have it used on you for surgery? Midazolam (Dormicum) has this property, and is routinely used in anaesthesia for that purpose (patient partially wakes up during surgery, has an unpleasant experience, the drug is administered to erase short time memory (mostly)). Many other drugs (some antibiotics, also alcohol) also have this property. Speaking of alcohol: anyone who considers that consciousness is a boolean property is very welcome to a personal experiment involving measuring correlation of the degree of awareness with alcohol content in blood, titrating until loss of consciousness. When I was in high school, I read that dentists were considering use of a new anasthetic with this property. I was revolted, and even more revolted when none of my friends could see anything wrong with it. I understand such drugs are currently considered for an early therapy for traumatic incidents (if you can't remember it, you won't be traumatized by recurring memories). Experiences are real, whether you remember them or not. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: More is Better (was RE: another puzzle)
On Thu, Jun 30, 2005 at 07:07:35PM -0700, Jonathan Colvin wrote: I'm sure they are. Awareness with no memory would be complete confusion (you'd have no idea what any of your sense qualia refer to; or of much else, E.g. severe Wernicke-Korsakoff syndrome patients have no short term memory. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Torture yet again
On Mon, Jun 27, 2005 at 10:42:17PM -0700, Lee Corbin wrote: No, it's not the same program. What do you mean? I am postulating that it *is* the same sequence of code bytes, the *same* program. Do you know what I mean when I say that program A is the same program as program B? An instantiated program is much more than a sequence of bytes -- it also has state. Most programs do not have much state, but some (AI, specifically) are completely dominated by state. Another example is numerics, say, CFD code (which is simple, in numer of lines of code) computing a large system (which is not, because it contains TBytes of live data). The program is a really bad metaphor to describe intelligent observers. It is cleaner to describe the observer by state, and an engine interatively transforming the state. Whether the engine is mostly code or an ASIC, or a block of molecular circuitry doesn't matter from that perspective. It is this same, identical program that is running in two different places at the same time (pace relativity). Program A at location one is receiving input X and program A at position two is receiving input Y. I can't make it any clearer than that. I understood you perfectly. No, it is not the same program. A chess computer playing two different games are two distinct individuals. Two chess computers playing the same game (down to the clock cycle and single bit of state) are the same program. Assuming the devices don't store state, they boot up into a defined state, and then diverge either from system randomness or user input (abstractly, of course they will immediately diverge from clock skew and I/O with the real world, but it's only an illustration). Formally they're both flashed with HyperChess V3.0.4, and sloppily we can refer to them running the same program version. But these two systems are not identical, unless synchronized. You could say the space between your ears and mine enjoys the same physical laws, though. Both the arrangement of matter and the state of that matter (frozen-frame picture of spikes and gradients, gene activity, etc.etc) are very different. Of course. That's because the Eugen program is quite different from the Lee program. Now, the Eugen 2004 (March 23, 12:00:00) program is also somewhat different from the Eugen 2002 program (March 23, 12:00:00), but they are *very* similar in many, many ways. So many ways that we are justified in asserting that they are for all practical purposes the same person (and the same basic program). Biology doesn't make a clean distinction between software and hardware. I agree there is similiarity/homology between me-former and me-today, but that similiarity is difficult to measure at a low level. Synchronizing spatially separate discrete systems and make measurements on bit vectors is something relatively simple, at least in gedanken. Lee P.S. I had great, great difficulty in understanding anything that you had to say. I was not able to make most of it out. Perhaps you could add some redundancy to your tight prose? Sorry to be so dense, sometimes I have to post under time constraints, in a distracting environment. Will try to mend in future. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Torture yet again
On Sun, Jun 26, 2005 at 10:53:31AM -0700, Lee Corbin wrote: You can be in two places at the same time, but you can't enjoy two different scenarios, or think individual thoughts. I disagree. Again, you slide back and forth between instantiations and programs, which, as you know, are not the same thing. What you No, a system consists of a state, and iterated transformation upon a state. The physical system human, and physical laws acting upon it. The assembly of bits in a computer, and iterated transformation the computational engine is applying upon it. Whether that engine is software or hardware, is only relevant for implementation reasons. For complex organisms state dominates over the engine in terms of number of bits and complexity of its evolution. have written is true of an instance. Were we to be completely An instance is a process, execution of a static image. Processes are only the same when their trajectory (system evolution over state space) is identical. consistent using your terminology, then we would have to say that you could not think A and then think B, because each instance of you (in time, this time) cannot think more than one thing. How do you measure whether two instances are the same? By comparing each individual frame of the trajectory, bit by bit. If A is a sequence of frames as is B, both belonging to the same system evolving in time, they will not be same, unless forced by external constraints. Panta rhei, I am no longer the person I was yesteryear, etc. You have to look for more abstract homologies, extracting features from the trajectory, and comparing them. Two synchronized systems produce the same trajectory, by definition. A program can run in two different places at the same time, and the program (treated as the pattern) is perfectly capable of receiving input X in one location at the same time that it No, program is the wrong model. You can have identical pieces of a bit pattern (CD-ROM, human zygote), but they diverge when instantiated on different machines, given different input. Even given very homogenous instances (say, one C. elegans and another with very similiar neuranatomy, since genetically determined) they're processing different information, and representing different environments (e.g. sensing a chemical gradient). receives input Y in another. It would then be correct to say that the program was enjoying two different scenarios at the same time. No, it's not the same program. You could say the space between your ears and mine enjoys the same physical laws, though. Both the arrangement of matter and the state of that matter (frozen-frame picture of spikes and gradients, gene activity, etc.etc) are very different. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: another puzzzle
On Fri, Jun 24, 2005 at 11:23:33AM +1000, Eric Cavalcanti wrote: Furthermore, there is always some way to tell the difference between the copy and the original, in principle, even if that infomation is not epistemologically available to the subjects themselves. If the original flew to New York, then he This isn't true for two systems in the same quantum state./lunatic-fringe If you use two synchronized discrete systems, evolving along a trajectory in their state space they can't both encode their location by making measurements on their surroundings (due to synchronization constraint). One or both of them must be blind to the surroundings. The information about location must be encoded the environment around them, and be not accessible to the systems themselves at the same time. The difference, dear Brutus, is in the environment, not ourselves. would have interacted with the environment in a completely different way than if he stayed in the room, and that interaction deposits information about his trajectory in the environment in an irreversible manner. What do we care about something we cannot measure? I believe that the solution is not 3-rd person communicable. I believe that if I press the button 100 times, I'll never experience leaving the room, but there will be 100 copies of me claiming otherwise. That is because I believe You have diverged. Of course there are now many persons, suddenly. If you haven't diverged, you're only one person, and you can't both experience leaving the room and not leaving the room. that my 1-st person probability (in the sense of degree of belief) in this case is NOT equal to the fraction of functionally identical copies. I believe that my first person expectation is not measurable by 3rd parties. The only way I can be convinced otherwise is by doing the test. But then you would never know, because empirically (for 3rd parties) the result would be the same in either case. Run a synchronized SHRDLU simulation in two places, and ask it questions. Trivial experiment, and easy enough to do both in gedanken and in practice. Adding a physical robot arm only adds complication to the experiment, but it's the same in principle. I know that sounds somewhat solipsist in the end, but I can't believe that merely scanning me can affect my future. And I would like to be convinced otherwise, because I don't like solipsism. Why don't we terminate this pointless thread, until we can actually make numerical models of sufficiently complex animals and people, so the question completely renders itself irrelevant? -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Torture yet again
On Fri, Jun 24, 2005 at 05:08:39PM +0200, Bruno Marchal wrote: Le 23-juin-05, ? 05:38, Lee Corbin a ?crit : you *can* be in two places at the same time. From a third person pov: OK. From a first person pov: how? You can be in two places at the same time, but you can't enjoy two different scenaries, or think invidividual thoughts. It's a degenerate case, and rather uninteresting (but relevant for High Availability / Failover clusters -- HA, heartbeat, drbd, stonith). -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: another puzzzle
On Fri, Jun 24, 2005 at 06:52:11PM +0200, Bruno Marchal wrote: Why don't we terminate this pointless thread, until we can actually make numerical models of sufficiently complex animals and people, so the question completely renders itself irrelevant? You answer like if by making things more precise, automatically the question will then vanished away, like if you knew the theorem before No, the nature of identity and cognition can be already described with sufficient precision. It's just empirically threads about personal identity are fueled by sentiments similiar to now obsolete ones: those about phlogiston, vis vitalis and creationism. These, too, have gone round in circles for decades and centuries, leading pretty much nowhere. Statements I believe that first-person introspective view is special and I'm convinced cognition is not a physical process described by known physical laws or require deep quantum magic, continuity matters location is part of system identity, atoms themselves, not their spatiotemporal arrangement constitute identity are such sterile arguments. Ultimatively, they cannot be refuted by means other than a direct demonstration, preferrably from a first-person perspective (but even then, some observers will still remain unconvinced, claiming the zombie clause, or trying to get the experimenter persecuted for their murder). starting to find the axioms. But: replace sufficiently complex animals and people by sufficiently complex machines or by sufficiently rich theories, and then computer science and logic illustrate and enlighten *already* the relevance of the question and the high counter-intuitive character of the possible answers). Absolutely. Apparently, too counter-intuitive for some people to accept, despite based on solid seat-of-the-pants science and empirically refuted by daily routine in IT. But I don't think it is useful nor necessary to go to the math before understanding the intuitive but precise problems, and thought experiments like those in this (sequences) of threads are very illuminating. Why do you think the question is irrelevant? What do you Of course they're illuminating. But have they convinced many? It doesn't seem so. mean exactly, giving that some people works hard to got yes/no clearcut questions if only to be able to distinguish between the different ways *we* approach those questions. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Torture yet again
On Tue, Jun 21, 2005 at 04:05:02AM -0700, Jonathan Colvin wrote: Now, the funny thing is, if you replace torture by getting shot in the head, then I will pick (2). That's interesting, isn't it? Why is that interesting? It's indistinguishable from a teleportation scenario. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: copy method important?
On Sat, Jun 18, 2005 at 02:02:01PM -0700, Hal Finney wrote: In practice most people believe that consciousness does not depend critically on quantum states, so making a copy of a person's mind would not be affected by these considerations. It is interesting that there is still no publicly avialable FAQ on the nature of identity, given how often exactly the same issues come up, over the years. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: another puzzzle
On Fri, Jun 17, 2005 at 11:02:01AM +1000, Russell Standish wrote: Applying the SSA, the colour of the light when you first find yourself in the room is more likely to be the high measure state than the low measure state. (You didn't state what that colour was, but hopefully the fictional prisoner can remember it). The subjective duty cycle is 1:1. Because of the their minds perfectly synchronized constraint there's only one individuum. The number of instances doesn't matter, because they have no chance of experiencing anything else but what the sync master experiences. Unless I'm missing something there's no way to tell but to flip a coin, which gives you a 0.5 probability of being sent home. With the RSSA, subsequent states tell you no information whatsoever about which state is high measure. With the ASSA, you would expect that the light remains in one state most of the time (googol out of googol+1). So the fact that the light is alternating (and that you trust that the letter is in fact true) implies that the ASSA does not apply in this thought experiment. Cheers On Fri, Jun 17, 2005 at 12:12:59AM +1000, Stathis Papaioannou wrote: You find yourself in a locked room with no windows, and no memory of how you got there. The room is sparsely furnished: a chair, a desk, pen and paper, and in one corner a light. The light is currently red, but in the time you have been in the room you have observed that it alternates between red and green every 10 minutes. Other than the coloured light, nothing in the room seems to change. Opening one of the desk drawers, you find a piece of paper with incredibly neat handwriting. It turns out to be a letter from God, revealing that you have been placed in the room as part of a philosophical experiment. Every 10 minutes, the system alternates between two states. One state consists of you alone in your room. The other state consists of 10^100 exact copies of you, their minds perfectly synchronised with your mind, each copy isolated from all the others in a room just like yours. Whenever the light changes colour, it means that God is either instantaneously creating (10^100 - 1) copies, or instantaneously destroying all but one randomly chosen copy. Your task is to guess which colour of the light corresponds with which state and write it down. Then God will send you home. Having absorbed this information, you reason as follows. Suppose that right now you are one of the copies sampled randomly from all the copies that you could possibly be. If you guess that you are one of the 10^100 group, you will be right with probability (10^100)/(10^100+1) (which your calculator tells you equals one). If you guess that you are the sole copy, you will be right with probability 1/(10^100+1) (which your calculator tells you equals zero). Therefore, you would be foolish indeed if you don't guess that you in the 10^100 group. And since the light right now is red, red must correspond with the 10^100 copy state and green with the single copy state. But just as you are about to write down your conclusion, the light changes to green... What's wrong with the reasoning here? -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE
Re: collapsing quantum wave function
On Thu, Jun 09, 2005 at 04:09:15PM -0700, Norman Samish wrote: Does this mean that the quantum wave functions of all ten balls collapsed at the moment we viewed the record and observed what happened to 6? Or did the wave function never exist, since the robot's record always showed the identity of the destroyed ball, irrespective of whether a human observed this identity or not? In QM, it is not possible to distinguish featureless balls (systems in the same quantum state). Storing labels in an external system (robot) would perturb the systems, stopping them being featureless and/or precisely localized. Experimental limitations currently prevent experiments with system sizes much larger than a buckyball, IIRC. If you're talking about entangling several such systems (qubits), manipulating them by the robot should cause collapse of the total wavefunction -- you need to do it in QC to be able to read the result. IANAP, though, so above may be wrong. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Many Pasts? Not according to QM...
On Thu, Jun 09, 2005 at 02:04:00PM -0700, Hal Finney wrote: I was working on an essay on the nature of thought experiments about copying, but it got bogged down, so I will make this short. I am trying to analyze it based on evolutionary considerations. Copying is much like biological reproduction and we can expect many of the same effects in a society in which copying is a long-standing and widely used technology. Given the technology required for copying, it's a wash between Darwin and Lamarck. The most important effect is that making copies will be desirable. Just as genes try to reproduce themselves, so will people once that becomes possible, and for the same reason: successful reproducers occupy more of the universe's resources (i.e. have higher measure) and so these habits tend to become more widespread. Definitely. Given the nature of propagation across spacetime, there will be a selection for fastest replicators/travellers in the propagation wavefront. Convergent evolution there, big time. When we consider thought experiments involving copies, it is important to understand these effects. It is truly different to make a set of copies than to experience a probabilistic event. Making copies increases your measure in the world; flipping a coin does not. The decisions you will make in the two cases are different as a result. I am not my copy, after subjective chronon has passed after bifurcation. I can only observe my own branch, so does the other copy. One thought experiment was to consider two choices: flipping a coin and being tortured if it came up a certain way; versus making several copies and having one of them be tortured. Assuming the copies are all going to survive, clearly the latter would be the one selected by evolution. I have not fully understood the thinking behind torture/non torture gedanken. If a randomly selected branch gets tortured, I very much do not want to become that branch. If there are two scenarios, one with lots of branches, and one with far less, and still only one gets tortured, clearly the former is preferrable, if a choice has to be made. The probability of me being tortured next is lower that way. If all copies but the tortured one are synchronized then there are still only two outcomes, and I will be tortured with a 0.5 probability. So far, everything is obvious. What am I missing? Copying is such a bonus that it swamps consideration of quality of life. In a world where people have adapted to copying, they would work as hard to make a copy as they would in our world to avoid dying (each one changes measure by plus or minus 100%). As copying takes a cost, it's the same old rat race. Furthermore, the same technology allows you to keep remote backups, with incremental syncronisation and dead-man-switch instantiation. These are not copies, being static images, until instantiated. It might be objected that this approach does not shed much light on what our expectations would be or should be about what we will experience when we go through these transformations. I agree with the perspective that there is truly no fact of the matter about what it is like to have one of these things happen. All we can really do is look at the experiences and memory of each person, at each moment. No one will disagree about what each person at each moment remembers and how many of them there are. Clones are people with the same memory, until bifurcation. Synchronized clones are just one person, and can't differentiate in thinking/perception by the sync boundary condition. That is really all there is, factually. Our attempt to make these novel situations fit our conventional expectations don't work because we currently have an implicit assumption of mental continuity which is violated by copying experiments. There Subjectively, mental continuity is preserved (notice that this is necessarily true for meat people, yet we still do not consider them zombies, glossing over lacunes). Continuity really doesn't mean much, given Korsakoff patients, or confabulated memories. really is no meaningful and non-arbitrary way to map our current ways of thinking about the future to a world where copying is possible. But what we can do is really just as good: we can predict how people would and should behave. Which preferences will they have in these thought experiments? How hard will they work to achieve one option versus another? Evolutionary theory provides guidelines and examples we can use to understand how people will behave if and when copying becomes possible. If you have to copy, you have to split your possessions. Computational substrate isn't free, and it will be a scarce resource, given that copying a pattern is far quicker to build the substrate to contain it, even with molecular fabrication. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100
Re: Many Pasts? Not according to QM...
On Thu, Jun 09, 2005 at 02:10:51PM -0700, Jonathan Colvin wrote: If I take a loaf of bread, chop it half, put one half in one room and one half in the other, and then ask the question where is the loaf of bread?, we can likely agree that the question is ill-posed. The question what will I feel tomorrow only has an answer assuming that tomorrow there is a unique me. If I have been duplicated, there is no longer a definite answer to the question. There's always a unique me, subjectively. Each branch of the fork would have no trouble observing itself. If there's no forking, there's just only you, regardless how many instantiations. The evolution trajectory is identical. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Plaga
If you expect to be quoted correctly, stop posting HTML-only. On Thu, May 26, 2005 at 08:45:34AM -0500, aet.radal ssg wrote: HEY! BRUNO - I, (aet) didn't say that.nbsp;Someone elsenbsp;did. I was quoting them. If you're going to quote somebody, I suggest you get it right.BRBR- Original Message - BRFrom: Bruno Marchal [EMAIL PROTECTED]BRTo: aet.radal ssg [EMAIL PROTECTED]BRSubject: Re: Plaga BRDate: Wed, 25 May 2005 20:40:21 +0200 BRBRgt; BRgt; BRgt; Le 25-mai-05, à 17:59, aet.radal ssg a écrit : BRgt; BRgt; gt; From the initial page from the included link to the archive: I'm BRgt; gt; no physicist so I don't know for sure that these implications BRgt; gt; would BRgt; gt; follow, but I am very doubtful that interworld communication is consistent BRgt; gt; with the basics of quantum mechanics.nbsp; The fact that this paper has not BRgt; gt; been published in peer reviewed journals in 7 years indicates that it BRgt; gt; probably doesn't work. BRgt; BRgt; Ooh... you should not make inferences like that. I could give BRgt; you 10,000 reasons for not publishing. But I have not the time BRgt; because I have a deadline today! BRgt; BRgt; I red Plaga's paper. It is extremely interesting. It belongs to the BRgt; family of Weinberg's result. Some hoped that a slight BRgt; delinearisation of QM would explain the collapse. Reasoning a-la BRgt; Weinberg Plaga shows that it is the contrary which happens. Not BRgt; only we keep the MW but they became more real in some sense. It BRgt; shows the MWI is stable for slight variation of the SWE. this BRgt; confirms MWI in a deeper way. It shows quantum non linearity BRgt; contradicts thermodynamics! This is a powerful argument in favor of BRgt; both pure linear QM and MWI. BRgt; BRgt; (Good for me, it shows nature confirms the lobian machine's BRgt; inability to observe kestrels and starlings when they look enough BRgt; closely to themselves) BRgt; BRgt; Bruno BRgt; BRgt; http://iridia.ulb.ac.be/~marchal/ BRBR -- p___brSign-up for Ads Free at Mail.combr a href=http://mail01.mail.com/scripts/payment/adtracking.cgi?bannercode=adsfreejump01; target=_blankhttp://www.mail.com/?sr=signup/a/p BR -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Sociological approach
Please stop posting HTML-only. On Mon, May 23, 2005 at 07:29:28PM -0500, aet.radal ssg wrote: I think I can answer to the whole message by saying no way isn't always the way. The EPR paradox was supposed to prove quantum theory was wrong because it supposedly violated relativity. Alain Aspect proved that EPR actually worked as advertised, however it does so without violating relativity. Likewise I think there are ways that information, and perhaps other things, may be able to tunnel between worlds, despite the decoherence problem, of which I am well aware. Besides, Plaga has an experiment that is waiting to be tried that would prove other universes - A href=http://arxiv.org/abs/quant-ph/9510007;http://arxiv.org/abs/quant-ph/9510007/Anbsp;. Time will tell, but I think history is on my side.BRBR- Original Message - BRFrom: Patrick Leahy [EMAIL PROTECTED]BRTo: EverythingList EVERYTHING-LIST@ESKIMO.COMBRSubject: Re: Sociological approach BRDate: Mon, 23 May 2005 19:50:15 +0100 (BST) BRBRgt; BRgt; BRgt; QM is a well-defined theory. Like any theory it could be proved BRgt; wrong by future experiments. My point is that R. Miller's BRgt; suggestions would definitely constitute a replacement of QM by BRgt; something different. So would aet.radal's (?) suggestion of BRgt; information tunnelling between macroscopic branches. The crucial BRgt; point, which is not taught in introductory QM classes, is the BRgt; theory of Quantum decoherence, for which see the wikipedia article BRgt; and associated references (e.g. the Zurek quant-ph/0306072). BRgt; BRgt; This shows that according to QM, the decay time for quantum BRgt; decoherence is astonishingly fast if the product ((position BRgt; shift)^2 * mass * temperature) is much bigger than the order of a BRgt; single atom at room temperature. Moreover, the theory has been BRgt; confirmed experimentally in some cases. BRgt; BRgt; Since coherence decays exponentially, after say 100 decay times BRgt; there is essentially no chance of observing interference phenomena, BRgt; which is the *only* way we can demonstrate the existence of other BRgt; branches. No chance meaning not once in the history of the BRgt; universe to date. BRgt; BRgt; No existing animal is small enough or cold enough to participate BRgt; directly in quantum interference effects (i.e. to perceptibly BRgt; inhabit different micro-branches simultaneously), hence my claim BRgt; that your behaviour system, whatever it is, must be in the BRgt; fully-decohered regime. BRgt; BRgt; I have to backpedal some though, because by definition an BRgt; intelligent quantum computer would be in this regime (in practice, BRgt; by being very cold). I certainly don't want to imply that this goal BRgt; is known to be impossible. BRgt; BRgt; NB: I'm in some terminological difficulty because I personally BRgt; *define* different branches of the wave function by the property of BRgt; being fully decoherent. Hence reference to micro-branches or BRgt; micro-histories for cases where you *can* get interference. BRgt; BRgt; Paddy Leahy BRgt; BRgt; == BRgt; Dr J. P. Leahy, University of Manchester, BRgt; Jodrell Bank Observatory, School of Physics amp; Astronomy, BRgt; Macclesfield, Cheshire SK11 9DL, UK BRgt; Tel - +44 1477 572636, Fax - +44 1477 571618 BRBR -- p___brSign-up for Ads Free at Mail.combr a href=http://mail01.mail.com/scripts/payment/adtracking.cgi?bannercode=adsfreejump01; target=_blankhttp://www.mail.com/?sr=signup/a/p BR -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07100, 11.36820http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE signature.asc Description: Digital signature
Re: Computational irreducibility and the simulability of worlds
On Sat, Apr 17, 2004 at 01:03:03AM -0700, Hal Finney wrote: How about Tegmark's idea that all mathematical structures exist, and we're living in one of them? Or does that require an elderly mathematician, a piece of parchment, an ink quill, and some scribbled lines on paper in order for us to be here? That wouldn't quite do. Just simulating this planet takes a lot of hardware. Just because you can write down Navier-Stokes it doesn't mean rivulets, streams and oceans spring into being. A little more work is required for that. It seems to me that mathematics exists without the mathematician. To me it seems the opposite is true. As long as it's an unfalsifyable prediction, there's not much point to pursue it further. And since computer science is a branch of mathematics, programs and program runs exist as well without computers. While I'm open to existence of a metalayer, built from information or otherwise, I'm very much opposed to mysticism. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Modern Physical theory as a basis for Ethical and Existential Nihilism
The previous message was actually off-list, but since you replied to the list as well: On Thu, Jan 22, 2004 at 05:07:29PM +1100, Stathis Papaioannou wrote: The study of why societies have certain ethical beliefs is a subject for evolutionary psychology, or anthropology/sociology (moving down the reductionist hierarchy), and the study of what brain processes underlie ethical beliefs and behaviour is a subject for neurophysiology/biochemistry/chemistry/ultimately quantum physics (moving up the reductionist hierarchy), but the actual experience of having an We agree so far. ethical belief, and its ultimate justification, is not subject to scientific study. It is the old philosophical distinction between qualia - Now that doesn't follow. the subjective experience in itself - versus a description of the brain processes underlying the subjective experience. Subjective experience is at I don't understand how you can detach the experience from the physical process generating the experience. Qualia is just process introspection artifacts. There isn't anything particularly interesting or deep about them. I don't understand why you think experiencing an instance of a class of behaviour algorithms, emerged from iterated interactions of agents invalidates scientific mode of inquiry. I'm interested in spiking networks. You can see your qualia just fine in a tool as coarse as fMRI. bottom simple, basic, irreducible. This does not by any means imply that there is anything mystical about it. I believe that there is a one to one, Ah, then disregard above diatribe. We don't seem to disagree. or possibly a many to one, relationship between brain states and mental states; a one to many relationship would imply that something magical was going on, and I cannot imagine how this could occur even in theory. To this extent, I believe that the identity theory of mind MUST be valid - but to say that a certain brain state is necessary and sufficient for the experience of a corresponding mental state is not to say that the mental state is the same thing as the brain state. I still don't understand why you think ethics isn't a noisy set of behaviour algorithms, and is not a domain of science. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable
On Tue, Jan 20, 2004 at 10:33:57PM -0800, CMR wrote: Yes! you've captured the gist and fleshed out the raw concept that hit me whilst reading your post on weightless computation; that's potentially the value of it as an avenue to explore, I think: that there is an equivalence/symmetry/correspondence by which the universe's map to one another but it's not direct(?) is it a form of information conveyance? hmmm.. While it is not possible to infer physics of the metalayer, it is possible to infer the number of bits necessary to encode this universe. Give the visible universe's timespace complexity (assuming, it's not just an elaborate fake rendered for a few observers, which is synononymous to postulating gods or a God), the metalayer needs to store an awful lot of bits, and track them over an awful lot of iterations (or represent time implicitly). It is very, very big, judged by our standards of computational physics. As such postulating matrioshka universes implies running very large simulations is essentially free, this is not true in a darwinian context (which applies for all places supporting imperfect replication and limited amount of dimensions). Reference time... -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable
On Wed, Jan 21, 2004 at 09:34:50AM -0800, CMR wrote: I'm familiar with the concept of a metalayer in software dev as a compatibility interface between apps etc.. So, in this case the meta-layer being I assume the interface between the universes abstractly and between the simulation and the platform concretely, or is it referring to the computational device itself that the simulation is running on (per your bit storage reference below)? The latter. Just ab abstraction of the physical layer embedding the simulation. The visible universe meaning ours(?) I assume, and the the bit storage Yes. accounting for our 4th Dimensional progression? That depends whether we're an object, or a process in the metalayer. matrioshka = nested I assume as in the dolls; I interpret this to mean that Yes, e.g. us implementing a virtual universe large enough to include observers. The limitations of the host substrate (relativistic universe of limited duration, constraints of computational physics -- upper limit to the bits and number of operations on these bits). selection would favor a universal resource economy of high efficiency and so the cost of simulating a universe of at least our's complexity would be deleterious to the survival of the host universe and thus lower it's relative fitness? Or am I full of it here? No, this is not selection of universes, just motivations of systems occupying an universe. Matter and energy is a scarce commodity in the current universe, so assuming an universe we're currently observing is not doesn't require trivial resources to run there's a negative pressure on the motivations to run it. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Fri, Jan 16, 2004 at 10:27:49AM +0800, David Barrett-Lennard wrote: I agree with everything you say, but did you really think I was making a point because Eugen happened to use hex?! I've fallen behind on answering my email, so sorry if this is brief and a bit out of context. This post is not talking about the universe metalayer at all. I was using a specific natural number (a 512 bit integer) as an example for creation and destruction of a specific integer (an instance of a class of integers). No more, no less. Existence of a specific integer has nothing to do with existence of a production system for a class of integers. The recipe for a series is not the dish itself. That recipe is also just information, requiring encoding in a material carrier. It would have taken considerably more work to eradicate the entire production system, as it is a bit more widespread, and has a lot more vested interest than conservation of a specific, random integer, destilled from turbulent gas flow. The representation (hex, need to be told that above hex string represents an integer (ignoring underlying representations as two's complements, potentials, charge buckets and magnetic domains for the moment) indicates that even that simple information transfer was encrusted with lots of implicit context people take for granted. Roll back to Sumer, and hand out little clay tablets with that hex string. What does it mean? Nothing. Not even the alphabet to parse this exists. Animals evolve representations for quantities, because resource management is a critical survival skill. After a few iterations you get consensual encodings for interactive transfer, then noninteractive consensual encodings. I used patterns of luminous pixels (translated into Braille dots, for all what I know) instead of scratches on a bone fragent, because that encoding is more familiar, and easier to transmit. Wavefront reemitted from pebbles hitting retina, being processed on the fly, tranformed into a spatiotemporal electrochemical activity pattern is an instance of a measurement of a property. It takes a specific class of detectors to do. You cannot conduct that measurement in their absence. You say the given integer exists because it is it is physically realizable *in principle*. That sounds like the platonic view to me - To me, this sounds like a confusion between a specific integer, and a recipe for such. It is quite difficult to feed a wedding throng with pages from a cookbook. because the number is *not* actually physically realized and yet the number is purported to have an independent existence. Are you saying otherwise? I think any form of symbolic manipulation of numbers is implicitly using the platonic view. To say they spring into existence as they are written down (which in any case only means they are realizable in Numbers don't write down themselves. Systems generate them, translate them into specific encodings, to be parsed by other instances of systems of the same class. Use a system of a different class, and you'll only parse garbage. ATGATAGTGGCCGTCCAACGGTAGACTCTAC might be a number, it might also be a shorthand for a linear biopolymer (5'-3'? there's some implicit context for you). principle) just seems silly to me. A cookbook is a promise of a meal, not the meal itself. The Platonic view just says that every mathematical system free from contradiction exists. Ie if it can exist then it does exist. There is Exists where? Two production systems of the same kind generate the same output. Surely, the output is contained within them? In there, somewhere? Mathematicians are production systems. Input is coffee, output is theorem. no need to talk about different types of reality. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Determinism
and Is the population of universes in the metaverse infinite, or just very, very large? How can we tell the difference? countable, thoughts are not only infinite but uncountably infinite. An 18th century poet could have said that. In that case, thoughts -- and persons -- comprise an even larger infinity than universes. And -- although this is another argument -- Apart from the fact that you're not providing any evidence for that, have you ever considered the number of possible states in a system as complex as the insides of a human noggin? If you look at how much trouble crypto people are having when bruteforcing meek DES, there's a lot of them bits in the space between our ears. at least a part of the universe would not behave deterministically. How can you tell the difference between random, and (deterministic) pseudorandom? The experimental answer: you can't, even for trivial sized assemblies. The question of free will and determinism is undecidedable for any being but the omnipotent, omniscient (and even transcendent, given that you have to violate the known laws of physics). If you tend to resist what I am suggesting, consider three things: 1. How do you even individuate thoughts so as to count them or correlate them with physical states? Is the belief that Mark Twain Why would anyone be so foolish do that? It takes a lot of trouble to even model single cells, save trivial-sized critters like a nematode. wrote Huckleberry Finn the same as or different from the belief that Samuel Clemens wrote Huckleberry Finn? Would that be one physical state you would seek to correlate with it or two? There are lots of well-discussed conceptual problems here. Does a GNUchess system running on SPARC, MIPS or x86 care much on which platform it runs? It still plays chess. 2. The mind-brain relation has sometimes been compared to the relation between software and hardware in computers. A certain With very good reasons, because it's a good model. software function might be endlessly realizable by different physical (hardware) configurations in different computers. Similarly, I See, you're agreeing. suppose, the same hardware configuration might realize different software functions in different computers. The analogy might break down, but this is the idea. Layers are a human design artifact, evolved systems tend to not have very well defined modularity. 3. The denial of reductionism does not necessarily entail belief in what is called a ghost in the machine, i.e., a soul or other mystical something. The denial of reductionism may instead imply that not only is there no ghost, there also is no machine (i.e., we don't behave in machine-like ways). (This is a point made by Searle.) Humans are always making analogies to well-known artifacts. Animals are complex, so are some (very few, very large ones) machines. Searle is locking in those aspects which the metaphor authors explicitly wanted to omit. Machines are not at all like animals. (In many aspects, yet). John, I am not sure I understand everything you said. One thing I would say along lines I think you suggest: Determinism suggests a closed system. If you don't have a closed system, you don't get What is a closed system? It depends on the scope. The universe is a closed system, arguably. Yet, there's a lot of state in there. deterministic predictiveness. Human thought is both holistic and You will observe that PRNGs are very deterministic, and utterly unpredictable. They are explicitly made to be anything but unlinear, but you of course can make a PRNG take input from the proverbial bicycle toppling in Peking. In fact, even many current computers take pains to tap physical noise, to effectively evade the known-inner-state attack. unclosable. Those features do not preclude mental causality, but they do preclude deterministic, causal laws. The dichotomy between PRNG and RNG (determinism, and free will) only makes sense if you're God. For us meek end users, the difference is undetectable. Well, I hope I have not bored you all, but I do think that there are considerations from the social sciences that bear on -- and possibly challenge -- Tegmark's thesis. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Wed, Jan 14, 2004 at 10:38:51AM +0800, David Barrett-Lennard wrote: You seem to be getting a little hot under the collar! Nope, just a bit polemic. I was getting tired of glib assertions, and needed to poke a stick, to find out what's underneath. Here is a justification of why I think arithmetical realism is at least very plausible... I'm all ears. Let's suppose that a computer simulation can (in principle) exhibit awareness. I don't know whether you dispute this hypothesis, but let's assume it and see where it leads. With you so far. We already have simulated critters with behaviour, and awareness of their environment. Computational neuroscience even attempts to do it with a high degree of biological realism. Let's suppose in fact that you Eugin, were able to watch a computer simulation run, and on the screen you could see people laughing, talking - perhaps even discussing ideas like whether *their* physical existence needs to be postulated, or else they are merely part of a platonic multiverse. A simulated person may stamp his fist on a simulated coffee table and say Surely this coffee table is real - how could it possibly be numbers - I've never heard of anything so That wouldn't be abstract numbers. You'd have a system with a state, evolving along a trajectory. In your case, that system state is being rendered (in realtime, I presume) for external observers. You'd be a bit pressed to enumerate all possible system trajectories, though. You'd run out of time and space even for very, very small assemblies. ludicrous!. Now Eugin, you may argue that the existence of this universe depends on the fact that it was simulated by a computer in our universe. I find Exactly. No implementation, no state, no trajectory. Information doesn't exist without systems encoding it. (This applies to this universe being the metalayer for a simulated system; I don't make any assumptions about our own metalayer, which is pretty meaningless, since unknowable unless). this a little hard to fathom - because computer simulations are deterministic and they give the same results whether they are run once or a thousand times. I find it hard to imagine that they leap into Absolutely. Provided, they're run. (In practice, you'll see system running floats are not as deterministic as you think). existence when they are run the first time. I'm particularly motivated by the universal dove-tailing program - which eventually generates the trace of all possible programs. I don't deny that this universe exists. I do deny that the metalayers is knowable in principle, provided that metalayers is not operated by cooperating beings (which is a very purple requirement). What I *am* interested in is a simple TOE, or a set of simple equivalent TOEs, which has enough predictive power to be usable with some finite amount of computation. Do you say that most of the integers don't exist because nobody has written them down? Yeah. I'm saying that, say, 0xf2f75022aa10b5ef6c69f2f59f34b03e26cb5bdb467eec82780c2ccdf0c8e100d38f20d9f3064aea3fba00e723a5c7392fba0ac0c538a2c43706fdb7f7e58259 didn't exist in this universe (with a very high probability, it being a 512 bit number, generated from physical system noise) before I've generated it. Now it exists (currently, as a hex string (not necessarily ASCII) on many systems around the world, rendered in diverse fonts), as soon as I remove all its encodings it's gone again. P00f! Ditto applies to generator systems -- they're a bit more widespread within a lightday from here (though most of them are concentrated within a fraction of a lightsecond), but you take them out -- all of them -- numbers cease to exist. They're gone, until something else comes along, and reinvents them. I can see your point when you say that 2+2=4 is meaningless without the physical objects to which it relates. However this is irrelevant No, they're meaningful without observers with world models. The physical objects (unless they're infoprocessing systems) can't observe themselves. because you are thinking of too simplistic a mathematical system! The only mathematical systems that are relevant to the everything-list are those that have conscious inhabitants within them. Within this self I don't know what conscious means, but machine vision systems and animals can sure count. No need to use vis vitalis for that. contained mathematical world we *do* have the context for numbers. It's a bit like the chicken and egg problem. (egg = number theory, chicken = objects and observers). Both come together and can't be pulled apart. You're anthopomorphising awfully. It sure nice to be a conscious observers, but most parts of this universe have been doing fine without, and given that multiverse exists, most of those seem to do without as well. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078
Re: Is the universe computable?
to think about this point. I guess David is right when he says that you seem to be getting a little hot under the collar! Yeah, I have only a very low tolerance for bullshit. About AR I did send a quote by the mathematician HARDY which sums up quite well my feeling about it. You can take a look at: http://www.escribe.com/science/theory/m4621.html I stand in direct contact with the basic fabric of reality, because I'm a mathematician. Bow before me, for I see the mind of God. Sorry, that's extremely weak, even for a mathematician. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Tue, Jan 13, 2004 at 12:24:07PM +0100, Bruno Marchal wrote: If I'd kill you, you'd have no chance of thinking that thought. Actually this is pure wishful thinking, unless you mean succeeding I was referring to a gedanken experiment, of course. to kill me and my counterparts in some absolute way, but how would There are several ways imaginable, I'll point you to http://www.foresight.org/NanoRev/Ecophagy.html I don't see how the manner of destruction of the local pocket of biological life (which seems to be the only one in the visible universe) has anything to do with the validity of the argument. It's just implementation details. you be able to do a thing like that. I will not insist on this startling consequence of COMP or QM, giving that you postulate physicalism at the start. See my thesis for a proof that physicalism is incompatible with comp. We have discuss the immortality question a lot in this list. Do we have an experimental procedure to validate these fanciful scenarios? Multiverses are nice and all; so what flavour of kool aid do you prefer? If I killed all animals capable of counting, abstract immaterial numbers would become exactly that: immaterial. OK. But immaterial does not mean not existing. Even a physicalist can accept that. Only very reductionist forms of physicalism reject that. If you insist to label me thusly. But, really, instead of glib assertions and pointers to your thesis (what has formal logic to do with reality?) you are not being very convincing so far. The universe does what it does, it certainly doesn't solve equations. So we agree. (but note that anything does what it does, so what is your point). My point is that formal systems are a very powerful tool with very small reach, unfortunately. People solve equations, when approximating what universe does. As such, QM is a fair approximation; it has no further reality beyond that. That is your opinion, which is not really relevant for the question we are talking about. Because we know that QM is not a TOE. You haven't heard? We don't have a TOE. If there's such a thing as a TOE, there might be several equivalent. I would really like to see an algorithm, showing that any TOEs are equivalent. H\psi=E\psi in absence of context is just as meaningless as 2+2=4. I can understand that point and respect that opinion, but what makes you so sure. Could you give me a context in which H\psiis not equal to E\psi ? Could you give me a context in which 2+2 is not equal to 4, and where 2, +, 4, = have their usual standard meaning? This is ridiculous. You're referring to a specific notation, which needs systems to produce and to parse. Remove all instances of such systems, and everything is instanstly meaningless. Perhaps we should put our hypothesis on the table. Mine is comp by which I mean arithmetical realism, Church thesis, and the yes doctor hypothesis, that is the hypothesis that there is a level of description of myself such that I don't detect any differences in case my parts are functionaly substituted by digitalizable device. Do you think those postulates are inconsistent? I do not see how arithmetic realism (a special case of Platonic realism, is that correct?) is an axiom. I agree with the rest of your list. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
(itself a branch of computer science itself a branch of number theory. Ah, some severe leap of faith required here. If you find an error, or an imprecision, please show them. I'm experiencing a severe cognitive dissonance, trying to understand why you think formal systems do exist in absence of their production systems. Or, if there is a point you don't understand, it will be a pleasure for me to provide more explanations. Also, I thought you were postulating an universe, aren't you? (I just try Sure, we're having a conversation (albeit a bit surreal one), so we seem to exist. to figure out your philosophical basic hypothesis). Regards, Bruno -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Tue, Jan 13, 2004 at 05:30:10PM +0100, Georges Quenot wrote: No. They actually came to me while I was figuring some other ways of simulating a universe than the sequential one that seemed to give rise to many problems to me. The second one is influenced What's your take on how subjective timeflow looks like in a HashLife universe? http://www.ericweisstein.com/encyclopedias/life/HashLife.html -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Mon, Jan 12, 2004 at 03:50:42PM +0100, Bruno Marchal wrote: What I mean is that their arithmetical property are independent of us. Do you think those people believe that the proposition 17 is prime is meaningless without a human in the neighborhood? Of course it is meaningless. Natural numbers are representation clusters by infoprocessing systems: currently machines or animals. Pebbles can't count themselves, obviously. No realization without representation. I have no trouble seeing the universe as artifact from some production system (but that metalayer be transcendent by definition), but assuming universe exists because numbers exist does strike me as a yet another faith. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Is the universe computable?
On Mon, Jan 12, 2004 at 04:18:56PM +0100, Bruno Marchal wrote: Natural numbers are not representation. They are the one represented, for exemples by infosystems, or pebbles, animals etc. They are the one represented is a yet another assertion. I would be more inclined to listen, if you'd show how a group of pebbles can conduct a measurement. (Counting is a measurement). It seems to me you confuse the thing abstract immaterial numbers, and the things which represent them. If I'd kill you, you'd have no chance of thinking that thought. If I killed all animals capable of counting, abstract immaterial numbers would become exactly that: immaterial. Pebbles can't count themselves, obviously. But it is not because pebbles can't count that two pebbles give an even number of pebbles. Electron cannot solve schroedinger equation (only a physicist can do that), nevertheless electron cannot not follow it (supposing QM). The universe does what it does, it certainly doesn't solve equations. People solve equations, when approximating what universe does. As such, QM is a fair approximation; it has no further reality beyond that. H\psi=E\psi in absence of context is just as meaningless as 2+2=4. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE http://moleculardevices.org http://nanomachines.net pgp0.pgp Description: PGP signature
Re: Peculiarities of our universe
Why don't we see Others? I think the anthropic principle neatly explains both scenarios: why we're here, yet nobody else seems to be. If life nucleation density is arbitrarily low (e.g. 1/visible univers) we still wouldn't fail to observe our existance. It is also worthwhile to mention that the deep universe is young, and hasn't yet bred sufficient amount of metals (in the astronomic, not the chemical sense), so due to delayed hatching we're not yet in the lightcone of an advanced culture. I.e., don't look at the visible universe without a probability bias, proportional but thresholded (no H/He life for sure). It is relatively straightforward to show that an advanced culture is expansive, in fact relativistically so, and everything past pioneer wave will be transformed to become unsuitable for an ursoup. Arguably, we're about to enter that expansive stage (notice that computational physics seem to allow cognition at a 10^6 speedup, so the time from zero to hero is less than a year), and we've only become observable within less than a century, the high-power emitters less than three decades. What's the probability to observe a 0.9 c pioneer expansion wavefront, which will kill subexpansive observers (observation window: about a century?), will prevent emergence of new observers, and will only start in systems with sufficient metallicity, with a yet unknown (yet probably very low) nucleation density? Arbitrarily close to zero, obviously. So I would be very, very surprised if SETI people actually found the sky hanging full of ~lighthour 300 K blackbodies, or even if we found independant life nucleation events within our solar system (which have to compete with impact ejecta crosscontamination, a very frequent event). pgp0.pgp Description: PGP signature
Physics News Update 660 (fwd from physnews@aip.org)
- Forwarded message from [EMAIL PROTECTED] - From: [EMAIL PROTECTED] Date: Tue, 4 Nov 2003 11:11:46 -0500 To: [EMAIL PROTECTED] Subject: Physics News Update 660 Reply-To: [EMAIL PROTECTED] PHYSICS NEWS UPDATE The American Institute of Physics Bulletin of Physics News Number 660 November 4, 2003 by Phillip F. Schewe, Ben Stein, and James Riordon [...] ACCELERATION DISRUPTS QUANTUM TELEPORTATION, a new study has shown (Paul Alsing, University of New Mexico, 505-277-9094, [EMAIL PROTECTED]). In quantum teleportation (see http://www.aip.org/enews/physnews/1997/split/pnu350-1.htm), researchers create a pair of particles (such as photons) and cause them to interact so their properties become interrelated (a process called entanglement). Subsequently, after the particles go their separate ways, one can measure the first particle's properties (such as the direction its electric field is wiggling), destroy the particle (a requirement), and then instantly transmit (or teleport) its exact properties to the second particle, even if it ends up being light years away. Quantum teleportation is different from Star Trek teleportation in that real-life physicists are only teleporting a particle's properties, rather than the particle itself. Now, a new analysis has shown that quantum teleportation would malfunction if the receiver of the second particle is accelerating relative to the first particle. (Coincidentally, spaceships in Star Trek usually don't teleport crew members when they accelerate into warp drive.) The disruption to quantum teleportation arises from the Davis-Unruh effect (see http://focus.aps.org/story/v8/st19), in which acceleration, even in empty space, creates a bath of hot particles resulting from the energy of the acceleration. This thermal bath of particles inextricably disrupts the receiver's ability to perfectly recreate (with the second accelerated particle) the properties of the first (unaccelerated) particle that have been teleported from the sender. While this effect is small for typical accelerations in Earthly labs the result shows an interesting relationship between the effects of space-time motion and the quantum world. (Alsing and Milburn, Physical Review Letters, 31 October 2003) [...] *** PHYSICS NEWS UPDATE is a digest of physics news items arising from physics meetings, physics journals, newspapers and magazines, and other news sources. It is provided free of charge as a way of broadly disseminating information about physics and physicists. For that reason, you are free to post it, if you like, where others can read it, providing only that you credit AIP. Physics News Update appears approximately once a week. AUTO-SUBSCRIPTION OR DELETION: By using the expression subscribe physnews in your e-mail message, you will have automatically added the address from which your message was sent to the distribution list for Physics News Update. If you use the signoff physnews expression in your e-mail message, the address in your message header will be deleted from the distribution list. Please send your message to: [EMAIL PROTECTED] (Leave the Subject: line blank.) - End forwarded message - -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144 http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE pgp0.pgp Description: PGP signature
Re: Ideal lamps
On Sat, Oct 25, 2003 at 03:15:57PM -0700, Brent Meeker wrote: I don't know why anyone thought the speed of light had anything to do Maybe you should read up on general relativity. with this problem. The lamp can be at a single point and so can its A geometrical point has zero length and width and hence has no existence in the real universe. The Planck time quantum defines the smallest meaningful parcel of spacetime. At our current level of knowledge an oscillator takes a lot more resources than that to implement, and hence is huge in comparison. switch. Since nothing has to travel between switching events the speed of light is not relevant. By present theories the shortest An abstract clock has no existance. An implementation of a clock has physical extent, a cycle time, and a measurement process to go along with it. All of those are relativistically/quantum constrained. meaningful time interval is on the order of the Planck time ~10^-43 sec which depends on the gravitational constant and Planck's constant as well as the speed of light. Right. Given the speed of light, and the duration of Planck time quantum you can see the ultimate resolution level of a clock. The meaning of change of state ceases to exist once you go below that. -- Eugen* Leitl a href=http://leitl.org;leitl/a __ ICBM: 48.07078, 11.61144 http://www.leitl.org 8B29F6BE: 099D 78BA 2FD3 B014 B08A 7779 75B0 2443 8B29 F6BE pgp0.pgp Description: PGP signature
