[galaxy-dev] barcode splitter made 96 files. Is there a tool to map all of these files to the reference genome?
Hi, I have Rad tag data that I'm trying to map to our reference genome in Galaxy on our local instance. After barcode splitter, I have 96 files (one each of all of the sequences for that individual). It seems like the current tools (e.g. bowtie) can only map a single file to the reference. I think that even if I were to do this step 96 times, I would still end up with 96 files at the end and not the linkage map that I hoped for. Any ideas on how to move forward from this stage? -Lucinda ___ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] Velvetoptimizer won't read in my paired, illumina file
Hi. I have an illumina 1.9 file that I renamed, groomed, and interlaced to get to its current state (see first 2 sets of paired sequences below) @1 TTATCTGCATATACGAAATATACATTGAAAGTTGAAATAAATGATAAATTAAACCAATTA +1 @CCCDDC?DDDFHHHGIIGJJIIIHEIJHGECIDHHHGIEGIGDHDGIHGHF4IGIHEGIIGHCFIJIHDHF4IIJIHHIGIGFHGHHFFFDF@@B @1 TTTATCTACAAGCTAATTACAAGACATACTTACTTAAGTAAATTAAGATATATGGTTAATATTGCATTAAATAAGCTTTAATAAAGAGATAA +1 @CCDFFDFHHHGHJJJIIJJJIIIJJIIJIHIGGIBHGIHIHHIGIIIGHEIIICHGGHDHGIHHDIGIIICHGGDGFEG>EADECC7?CCDFD@C @2 ATTTATACATCTGTTGAACAAGTTATTAATTCTGCGATCTAATGTTATCACTTGTCCTCCCACATAGATCTTCATTCCTAAATTTATA +2 ;,(>5(5((>3;AC>@@;3;?:DEHA;=A@55)((8)(6HGB8F?9C3>C(>>C> Now I want to do an initial assembly with velvetoptimizer on my local instance of Galaxy. When I run velvetoptimizer, calling this file a fastq file of short paired reads, it fails and I get this error message: SyntaxError: unexpected character after line continuation character Any ideas on what I'm doing wrong? Thanks! -Lucinda ___ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] fastx reverse compliment failed - gzip: stdout: Broken pipe
I'm reposting over here from the user side, since this is a local instance, and it was recommended. Hi all, We are running Galaxy on an Ubuntu 11.10 computer (5 TB, stripped, etc.). We are assembling a small genome (110 Gb). Our dataset isn't directly uploaded, but is accessed from a directory (if that matters). Everything went fine through the FASTQ Groomer, but when we ran Reverse-Compliment, we got the following error: fastx_reverse_complement: writing quality scores failed: File too large gzip: stdout: Broken pipe Any help that you might have would be greatly appreciated! Thanks! As a follow up, the file that we're trying to reverse compliment is ~26 Gb. The files seem to work fine until 2.1 Gb. There is plenty of memory (we have 3.4 Tb free on this system) and it doesn't seem to be an issue with the permissions or partitions. I also made sure that the Gzip and connectors to perl are up to date. And I have set everything in ulimit to be unlimited (so there are no issues for Ubuntu for the file size creation). This is a local instance, btw, though I'm sure that's obvious... We were able to groom the files to create the 26Gb file that we want to work with, so it seems like the computer should be able to do all of this... Any thoughts? ___ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
