Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file

2013-08-14 Thread Vandeweyer Geert 
Also through toolshed, version 0.5.9-r16. An example error on our part is 
(SamToBam):

Error extracting alignments from 
(/galaxy/galaxy-dist/database/files/067/dataset_67090.dat), [samopen] SAM 
header is present: 25 sequences.
Parse error at line 261924: sequence and quality are inconsistent
Aborted


That line  in the sam does show sequence/qual inconsistency in length:

HWI-1KL167:27:D1NADACXX:4:2315:10415:96156  0   chr1152187281   
0   99M *   0   0   
CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA
 BBBFFBIFFFBFFBBFBFBBB   XT:A:U   NM:i:1  X0:i:1  X1:i:0  
XM:i:1  XO:i:0  XG:i:0  MD:Z:33A65


fastq file fed to BWA holds the correct info:
@HWI-1KL167:27:D1NADACXX:4:2315:10415:96156 1:N:0:GTGGCC
CTGGAAGACTGACCTGTGCTAGATCCCTCCTGGTCAAAGGTTGATGACTGTCCTGATGTAGAACCATGCTGTCCTTGGCTACAGAAGTGCCCTGAGCCA
+
BBBFFBIFFFIFIIFFFFIIFFIIIFFBFFBFIBFBBBFBmailto:bjoern.gruen...@gmail.com>> wrote:
Hi Moritz,

do you installed bwa through the toolshed or manually?

Cheers,
Bjoern

> Hey Folks,
>
>
> Is there really nobody that can help Geert and me? Thats quite
> important to me right now.
> This is obviously not something specific to me, as Geert has the exact
> same error.
> I meanwhile tried to replace the id with "1" but it still doesnt work.
>
>
> Best
> Moritz
>
> __
> Von: galaxy-dev-boun...@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer
> Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam,
> Berlin, Bern, Rom, Stockholm, Wien
> An: galaxy-dev@lists.bx.psu.edu
> Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
>
> to add on this :
>
> we have similar issues (sam-to-bam conversion fails with similar
> errors). it seems to be related to the BWA output getting messed up,
> with (part of) columns missing or duplicated on some lines.
>
> I have not found a systematic pattern in the errors, they seem to
> happen rather random.
>
>
>
> On 08/08/2013 05:06 PM, Moritz Juchler wrote:
> Dear Galaxy Community,
>
> I have a local instance and installed 0.5.9-r16 BWA and  the toolshed
> wrapper. The mapping is successful. I then use the Filter Sam Tool on
> the sam file from the alignment, but it spits out this error:
>
> Dataset 26: Filter SAM on data 24
>
> Tool execution generated the following error message:
>
> Traceback (most recent call last):
>   File
> "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> line 148, in 
> if __name__ == "__main__": main()
>
>   File
> "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> line 137, in main
> flags = int( fields[flag_col] )
> ValueError: invalid literal for int() with base 10:
> 'RG:Z:lane712s006433'
>
>
>
>
> I have the same workflow online and did the exact same steps on the
> same fastq files.
> Is there anything I am missing? Is there any information I can provide
> to answer this question?
>
> Best
> Moritz
>
>
>
>
> ___
> Please keep all replies on the list by using "reply all"
> in your mail client.  To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
>   http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/
>
>
>
> --
>
> Geert Vandeweyer, Ph.D.
> Department of Medical Genetics
> University of Antwerp
> Prins Boudewijnlaan 43
> 2650 Edegem
> Belgium
> Tel: +32 (0)3 275 97 56
> E-mail: 
> geert.vandewe...@ua.ac.be>
> http://ua.ac.be/cognitivegenetics
> http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
>
>
>
>
>
> ___
> Please keep all replies on the list by using "reply all"
> in your mail client.  To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
>   http://lists.bx.psu.edu/
>
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/





___
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file

2013-08-14 Thread Moritz Juchler 
Through toolshed.


On 14 August 2013 12:50, Bjoern Gruening  wrote:

> Hi Moritz,
>
> do you installed bwa through the toolshed or manually?
>
> Cheers,
> Bjoern
>
> > Hey Folks,
> >
> >
> > Is there really nobody that can help Geert and me? Thats quite
> > important to me right now.
> > This is obviously not something specific to me, as Geert has the exact
> > same error.
> > I meanwhile tried to replace the id with "1" but it still doesnt work.
> >
> >
> > Best
> > Moritz
> >
> > __
> > Von: galaxy-dev-boun...@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer
> > Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam,
> > Berlin, Bern, Rom, Stockholm, Wien
> > An: galaxy-dev@lists.bx.psu.edu
> > Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
> >
> > to add on this :
> >
> > we have similar issues (sam-to-bam conversion fails with similar
> > errors). it seems to be related to the BWA output getting messed up,
> > with (part of) columns missing or duplicated on some lines.
> >
> > I have not found a systematic pattern in the errors, they seem to
> > happen rather random.
> >
> >
> >
> > On 08/08/2013 05:06 PM, Moritz Juchler wrote:
> > Dear Galaxy Community,
> >
> > I have a local instance and installed 0.5.9-r16 BWA and  the toolshed
> > wrapper. The mapping is successful. I then use the Filter Sam Tool on
> > the sam file from the alignment, but it spits out this error:
> >
> > Dataset 26: Filter SAM on data 24
> >
> > Tool execution generated the following error message:
> >
> > Traceback (most recent call last):
> >   File
> > "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> > line 148, in 
> > if __name__ == "__main__": main()
> >
> >   File
> > "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> > line 137, in main
> > flags = int( fields[flag_col] )
> > ValueError: invalid literal for int() with base 10:
> > 'RG:Z:lane712s006433'
> >
> >
> >
> >
> > I have the same workflow online and did the exact same steps on the
> > same fastq files.
> > Is there anything I am missing? Is there any information I can provide
> > to answer this question?
> >
> > Best
> > Moritz
> >
> >
> >
> >
> > ___
> > Please keep all replies on the list by using "reply all"
> > in your mail client.  To manage your subscriptions to this
> > and other Galaxy lists, please use the interface at:
> >   http://lists.bx.psu.edu/
> >
> > To search Galaxy mailing lists use the unified search at:
> >   http://galaxyproject.org/search/mailinglists/
> >
> >
> >
> > --
> >
> > Geert Vandeweyer, Ph.D.
> > Department of Medical Genetics
> > University of Antwerp
> > Prins Boudewijnlaan 43
> > 2650 Edegem
> > Belgium
> > Tel: +32 (0)3 275 97 56
> > E-mail: geert.vandewe...@ua.ac.be
> > http://ua.ac.be/cognitivegenetics
> > http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
> >
> >
> >
> >
> >
> > ___
> > Please keep all replies on the list by using "reply all"
> > in your mail client.  To manage your subscriptions to this
> > and other Galaxy lists, please use the interface at:
> >   http://lists.bx.psu.edu/
> >
> > To search Galaxy mailing lists use the unified search at:
> >   http://galaxyproject.org/search/mailinglists/
>
>
>
>
___
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-dev] Fwd: Map with BWA results in correpted SAM file

2013-08-14 Thread Bjoern Gruening 
Hi Moritz,

do you installed bwa through the toolshed or manually?

Cheers,
Bjoern

> Hey Folks,
> 
> 
> Is there really nobody that can help Geert and me? Thats quite
> important to me right now.
> This is obviously not something specific to me, as Geert has the exact
> same error.
> I meanwhile tried to replace the id with "1" but it still doesnt work.
> 
> 
> Best
> Moritz
> 
> __
> Von: galaxy-dev-boun...@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer
> Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam,
> Berlin, Bern, Rom, Stockholm, Wien
> An: galaxy-dev@lists.bx.psu.edu
> Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file
> 
> to add on this :
> 
> we have similar issues (sam-to-bam conversion fails with similar
> errors). it seems to be related to the BWA output getting messed up,
> with (part of) columns missing or duplicated on some lines.
> 
> I have not found a systematic pattern in the errors, they seem to
> happen rather random.
> 
> 
> 
> On 08/08/2013 05:06 PM, Moritz Juchler wrote:
> Dear Galaxy Community,
> 
> I have a local instance and installed 0.5.9-r16 BWA and  the toolshed
> wrapper. The mapping is successful. I then use the Filter Sam Tool on
> the sam file from the alignment, but it spits out this error:
> 
> Dataset 26: Filter SAM on data 24
> 
> Tool execution generated the following error message:
> 
> Traceback (most recent call last):
>   File
> "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> line 148, in 
> if __name__ == "__main__": main()
> 
>   File
> "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
> line 137, in main
> flags = int( fields[flag_col] )
> ValueError: invalid literal for int() with base 10:
> 'RG:Z:lane712s006433'
> 
> 
> 
> 
> I have the same workflow online and did the exact same steps on the
> same fastq files.
> Is there anything I am missing? Is there any information I can provide
> to answer this question?
> 
> Best
> Moritz
> 
> 
> 
> 
> ___
> Please keep all replies on the list by using "reply all"
> in your mail client.  To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/
> 
> 
> 
> --
> 
> Geert Vandeweyer, Ph.D.
> Department of Medical Genetics
> University of Antwerp
> Prins Boudewijnlaan 43
> 2650 Edegem
> Belgium
> Tel: +32 (0)3 275 97 56
> E-mail: geert.vandewe...@ua.ac.be
> http://ua.ac.be/cognitivegenetics
> http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
> 
> 
> 
> 
> 
> ___
> Please keep all replies on the list by using "reply all"
> in your mail client.  To manage your subscriptions to this
> and other Galaxy lists, please use the interface at:
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/


___
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/

[galaxy-dev] Fwd: Map with BWA results in correpted SAM file

2013-08-14 Thread Moritz Juchler 
Hey Folks,

Is there really nobody that can help Geert and me? Thats quite important to
me right now.
This is obviously not something specific to me, as Geert has the exact same
error.
I meanwhile tried to replace the id with "1" but it still doesnt work.

Best
Moritz

__
Von: galaxy-dev-boun...@lists.bx.psu.eduIm Auftrag vonGeert Vandeweyer
Gesendet: Donnerstag, 8. August 2013 17:18:59 (UTC+01:00) Amsterdam,
Berlin, Bern, Rom, Stockholm, Wien
An: galaxy-dev@lists.bx.psu.edu
Betreff: Re: [galaxy-dev] Map with BWA results in correpted SAM file

to add on this :

we have similar issues (sam-to-bam conversion fails with similar errors).
it seems to be related to the BWA output getting messed up, with (part of)
columns missing or duplicated on some lines.

I have not found a systematic pattern in the errors, they seem to happen
rather random.



On 08/08/2013 05:06 PM, Moritz Juchler wrote:
Dear Galaxy Community,

I have a local instance and installed 0.5.9-r16 BWA and  the toolshed
wrapper. The mapping is successful. I then use the Filter Sam Tool on the
sam file from the alignment, but it spits out this error:

Dataset 26: Filter SAM on data 24

Tool execution generated the following error message:

Traceback (most recent call last):
  File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
line 148, in 
if __name__ == "__main__": main()

  File "/home/trr/galaxy-dist/tools/samtools/sam_bitwise_flag_filter.py",
line 137, in main
flags = int( fields[flag_col] )
ValueError: invalid literal for int() with base 10: 'RG:Z:lane712s006433'




I have the same workflow online and did the exact same steps on the same
fastq files.
Is there anything I am missing? Is there any information I can provide to
answer this question?

Best
Moritz



___
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/



--

Geert Vandeweyer, Ph.D.
Department of Medical Genetics
University of Antwerp
Prins Boudewijnlaan 43
2650 Edegem
Belgium
Tel: +32 (0)3 275 97 56
E-mail: geert.vandewe...@ua.ac.be
http://ua.ac.be/cognitivegenetics
http://www.linkedin.com/pub/geert-vandeweyer/26/457/726
___
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/