[galaxy-user] My tophat jobs are stuck in the queue

[Daniel Lundin]

Hi,

I've been running small tophat jobs as part of a student exercise, but 
since yesterday morning (about 7 am CET, or 24 hours ago) my tophat jobs 
does not start. Earlier (Monday) jobs started and finished fine. Other 
jobs like trimming, getting data from the Main table etc. works.


/D

--
Daniel Lundin, Postdoc
SciLifeLab, School of biotechnology,
KTH Royal institute of technology,
Stockholm, Sweden

Postal address:
Box 1031
171 21 Solna
Sweden

Visiting address:
Tomtebodavägen 23 A

Mobile: +46 (0)708 123 922
Email: daniel.lun...@scilifelab.se
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] CompleteGenomics publicly available genomes.

[Ronald Worthington]

This is a bizarre problem.

The CGI genomes are available on the Bionimbus cloud, but not accessible 
through Bionimbus instances. You have to download them and upload them back 
into your Bionimbus space. Same for Amazon S3/EC2. This is crazy. CGI uploads 
everything to Amazon, and then they send out hard drives, and customers cannot 
even access their Amazon uploaded-data, on the cloud, that CGI used to burn the 
physical drives! So much bandwidth is just being wasted. Talk about a green 
issue!

 - Ron


On Oct 11, 2011, at 4:08 PM, Melissa A. Wilson Sayres wrote:

> Is there a plan to add the 69 publicly available genomes from 
> CompleteGenomics to the SharedData in Galaxy?
> 
> http://www.completegenomics.com/sequence-data/download-data/
> 
> I am planning to do some analysis of a subset of these genomes in Galaxy (and 
> I think many more in the future). I also think many CompleteGenomics users 
> would be more likely to use Galaxy if the masterVar files were already 
> available in Galaxy
> 
> I just wanted to check if it was already on the list, before I uploaded them 
> myself. 
> 
> Thanks,
> Melissa
> 
> 
> 
> -- 
> Melissa A. Wilson Sayres, PhD
> Miller Fellow
> University of California, Berkeley
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>  http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>  http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] CompleteGenomics publicly available genomes.

[Melissa A. Wilson Sayres]

Is there a plan to add the 69 publicly available genomes from
CompleteGenomics to the SharedData in Galaxy?

http://www.completegenomics.com/sequence-data/download-data/

I am planning to do some analysis of a subset of these genomes in Galaxy
(and I think many more in the future). I also think many CompleteGenomics
users would be more likely to use Galaxy if the masterVar files were already
available in Galaxy

I just wanted to check if it was already on the list, before I uploaded them
myself.

Thanks,
Melissa



-- 
Melissa A. Wilson Sayres, PhD
Miller Fellow
University of California, Berkeley
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Problem with Cuffcompare

[Chandu Galaxy]

Thank you for the response.
I can't check my reference genome dataset because I'm using reference
provided by Galaxy (*Mosquito (Anopheles gambiae): AgamP3*). Is there any
solution? Thank you.

--
Chandu



On Mon, Oct 10, 2011 at 7:15 AM, Jeremy Goecks wrote:

>
> Tool execution generated the following error message:
>
> Error running cuffcompare. Warning: Your version of Cufflinks is not 
> up-to-date. It is recommended that you upgrade to Cufflinks v1.1.0 to benefit 
> from the most recent features and bug fixes (http://cufflinks.cbcb.umd.edu).
> No fasta index found for ./input1. Rebuilding, please wait..
> Error: sequence lines in a FASTA record must have the same length!
>
> Chandu,
>
> Cufflinks/compare/diff requires that your reference genome dataset have the
> following format:
>
> >my_chrom
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT
> ...
>
> Note that all lines of sequence data have the same length.
>
> The problem you're seeing is because there are lines in your sequence data
> that are not the same length, e.g.
>
> >my_chrom
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGT
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTA
> AGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCGGTAGTTACCG
> ...
>
> The FASTA Width tool in Galaxy can help you format your dataset correctly.
>
> Good luck,
> J.
>
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] tophat error

[Jennifer Jackson]

Hi Zohra,

One more bit of help: in the past our team has noticed that Color Space 
files from NCBI's SRA database have a "placeholder" adapter base quality 
score added in (for an unknown reason).


If you choose to use Galaxy, when passing the file through the FASTQ 
Groomer tool (with input and output type set to cssanger) this extra 
score is removed. This standardizes the data and makes it useable with 
analysis tools such as Bowtie/TopHat.


The same thing could be done on the command line (removing the initial 
qual score for each FASTQ entry) if that is an option for you.


Best wishes for your project,

Jen
Galaxy team




On 10/11/11 12:14 PM, Jennifer Jackson wrote:

Hello Zohra,

For command line (not Galaxy) use of this tool, questions would be best
directed to the tool authors at tophat.cuffli...@gmail.com. That said,
there appears to be a mismatch between the quality scores in your fastq
file and what was expected (integer, linked to the -C option).

Should you decide to use Galaxy at http://usegalaxy.org, there are tools
to format the input and run this type of job. To help you get started,
please see our tutorial covering this exact type of analysis:

http://wiki.g2.bx.psu.edu/Learn/Screencasts
see "Examples of other analyses -> SOLiD Single End"

Hopefully one of these options will work out for you,

Best,

Jen
Galaxy team

On 10/11/11 7:47 AM, zohra saci wrote:



Hello,
I was trying to run tophat v1.3.2 on SOLID data and I have this error:
*zohra@bart:~/Bureau/cancer$ tophat -o /tmp/tophat_SRR036752/ -g 1 -p 4
-C /home/zohra/indexes_bowtie/humain_ SRR036752.fastq

[Tue Oct 11 13:23:53 2011] Beginning TopHat run (v1.3.2)
---
[Tue Oct 11 13:23:53 2011] Preparing output location
/tmp/tophat_SRR036752//
[Tue Oct 11 13:23:53 2011] Checking for Bowtie index files
[Tue Oct 11 13:23:53 2011] Checking for reference FASTA file
[Tue Oct 11 13:23:53 2011] Checking for Bowtie
Bowtie version: 0.12.7.0
[Tue Oct 11 13:23:53 2011] Checking for Samtools
Samtools Version: 0.1.18
[Tue Oct 11 13:23:53 2011] Generating SAM header for
/home/zohra/indexes_bowtie/humain_
[Tue Oct 11 13:23:55 2011] Preparing reads
format: fastq
quality scale: phred33 (default)
[FAILED]
Error running 'prep_reads'
Error: qual length (51) differs from seq length (51) for fastq record !
*
Can you help me.
Thanks
Zohra Saci



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/




--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org/Support
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] SNP and INDEL detection

[Jennifer Jackson]

Hello Maria,

Good tool groups to start with are: "NGS: SAM Tools" and "NGS: Indel 
Analysis".


Once you have SNP/Indel the coordinates in BED/Interval format, the 
tools in group "Operate on Genomic Intervals" can be used to compare the 
two datasets.


Thanks for using Galaxy! Please let us know if you need more help,

Jen
Galaxy team


On 10/11/11 10:34 AM, Gabriela Ronquillo-Lopez wrote:

Hello,

I am new using Galaxy, I would like ask if it is possible to perform a
SNP and INDEL analysis between two SAM files (mutant and wt) with
Galaxy. If so, could anyone give a hint in how to proceed?

Many thanks for your help in advance,

Kind regards,

Maria G.



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org/Support
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] tophat error

[Jennifer Jackson]

Hello Zohra,

For command line (not Galaxy) use of this tool, questions would be best 
directed to the tool authors at tophat.cuffli...@gmail.com. That said, 
there appears to be a mismatch between the quality scores in your fastq 
file and what was expected (integer, linked to the -C option).


Should you decide to use Galaxy at http://usegalaxy.org, there are tools 
to format the input and run this type of job. To help you get started, 
please see our tutorial covering this exact type of analysis:


http://wiki.g2.bx.psu.edu/Learn/Screencasts
see "Examples of other analyses -> SOLiD Single End"

Hopefully one of these options will work out for you,

Best,

Jen
Galaxy team

On 10/11/11 7:47 AM, zohra saci wrote:



Hello,
I was trying to run tophat v1.3.2 on SOLID data and I have this error:
*zohra@bart:~/Bureau/cancer$ tophat -o /tmp/tophat_SRR036752/ -g 1 -p 4
-C /home/zohra/indexes_bowtie/humain_ SRR036752.fastq

[Tue Oct 11 13:23:53 2011] Beginning TopHat run (v1.3.2)
---
[Tue Oct 11 13:23:53 2011] Preparing output location /tmp/tophat_SRR036752//
[Tue Oct 11 13:23:53 2011] Checking for Bowtie index files
[Tue Oct 11 13:23:53 2011] Checking for reference FASTA file
[Tue Oct 11 13:23:53 2011] Checking for Bowtie
Bowtie version: 0.12.7.0
[Tue Oct 11 13:23:53 2011] Checking for Samtools
Samtools Version: 0.1.18
[Tue Oct 11 13:23:53 2011] Generating SAM header for
/home/zohra/indexes_bowtie/humain_
[Tue Oct 11 13:23:55 2011] Preparing reads
format: fastq
quality scale: phred33 (default)
[FAILED]
Error running 'prep_reads'
Error: qual length (51) differs from seq length (51) for fastq record !
*
Can you help me.
Thanks
Zohra Saci



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org/Support
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] Q about 'Compute' tool

[Jennifer Jackson]

Hello Ian,

The Compute tool accepts python operator functions. These functions are 
applied individually to each line in the input dataset.


In the Compute tool's help (lower portion of the form), simple examples 
are shown that demonstrate how the variables c1, c2, etc. will be 
interpreted as the column values in the input tabular dataset.


A suggested reference for syntax is this web resource:
http://docs.python.org/library/stdtypes.html#boolean-operations-and-or-not

Hopefully this helps,

Best,

Jen
Galaxy team

On 10/11/11 3:57 AM, Ian Donaldson wrote:

Thank Russell for the tip, it was just what i needed.  Is there a explanation 
of how to construct the instructions for 'Compute' somewhere?  I have not been 
able to find it.

Also thanks to Hans-Rudolf.

Ian

From: Russell Bell [russell.b...@hci.utah.edu]
Sent: 10 October 2011 18:16
To: galaxy-user@lists.bx.psu.edu; Ian Donaldson
Subject: Re: [galaxy-user] Q about 'Compute' tool

Ian,

using your
chr15001000geneA.+
chr120002500geneB.-

problem i was able to get

chr15001000geneA.+ 500.0
chr120002500geneB.- 2500.0

Using

 c2 if c6=='+' else c3

in the Compute tool.  See if it works for you.

-
Russell




Date: Mon, 10 Oct 2011 17:36:58 +0200
From: Hans-Rudolf Hotz
To: Ian Donaldson, Daniel Blankenberg
,   "galaxy-user@lists.bx.psu.edu"

Subject: Re: [galaxy-user] Q about 'Compute' tool
Message-ID:<4e93111a.4060...@fmi.ch>
Content-Type: text/plain; charset=ISO-8859-1; format=flowed



On 10/10/2011 04:45 PM, Ian Donaldson wrote:

Thanks, but not quite what i need.

If i start with two intervals:
chr15001000geneA.+
chr120002500geneB.-

I want to add via, e.g. 'Compute', the TSS position to the end of each
line.  The desired result being:

chr15001000geneA.+500
chr120002500geneB.-2500

This is because geneA is on the '+' strand and geneB is on the '-'
strand.



Hi Ian

Have you tried

"Filter and Sort"->  "Filter" data on any column using simple expressions

and create two lists containing all genes on the '+' strand and alles
genes on the '-' strand.

followed by
"Text Manipulation"->  "Cut" columns from a table

   using 'c1,c2,c3,c4,c5,c6,c2' for the list with all genes on the '+'
strand

   and

   using 'c1,c2,c3,c4,c5,c6,c3' for the list with all genes on the '-'
strand


and then you can create a single list again with

"Text Manipulation"->  "Concatenate" datasets tail-to-head


I guess this is waht you want, isn't-it?


Regards, Hans



Thanks,
Ian

From: Daniel Blankenberg [d...@bx.psu.edu]
Sent: 10 October 2011 14:34
To: Ian Donaldson
Cc: galaxy-user@lists.bx.psu.edu
Subject: Re: [galaxy-user] Q about 'Compute' tool

Hi Ian,

Under Operate on Genomic Intervals, you can try the "Get Flanks" tool;
you can request upstream, downstream, or both of your provided regions.
Please let us know if you need additional assistance.


Thanks for using Galaxy,

Dan


On Oct 10, 2011, at 6:35 AM, Ian Donaldson wrote:

Hi,

Can 'if' statements by used in 'Text manipulation'>   'Compute'?

The reason is that i have a interval file of UCSC genes, i want to
identify the TSS of each and make a new interval reflecting the TSS
position for each gene.  But because the TSS of a '-' stranded gene is
actually the 'end' coord i want to be able to check the strand in the
compute statement.

Is this possible or is there an easier way to do this inside GALAXY?

Thank you,
Ian
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the
list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/





___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/



--

___
galaxy-user mailing list
galaxy-user@lists.bx.psu.edu
http://lists.

[galaxy-user] SNP and INDEL detection

[Gabriela Ronquillo-Lopez]

Hello,

I am new using Galaxy, I would like ask if it is possible to perform a SNP
and INDEL analysis between two SAM files (mutant and wt) with Galaxy. If so,
could anyone give a hint in how to proceed?

Many thanks for your help in advance,

Kind regards,

Maria G.
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] tophat error

[zohra saci]

Hello,
I was trying to run tophat v1.3.2 on SOLID data and I have this error: 
zohra@bart:~/Bureau/cancer$ tophat  -o /tmp/tophat_SRR036752/  -g 1 -p 4 -C 
/home/zohra/indexes_bowtie/humain_ SRR036752.fastq 

[Tue Oct 11 13:23:53 2011] Beginning TopHat run (v1.3.2)
---
[Tue Oct 11 13:23:53 2011] Preparing output location /tmp/tophat_SRR036752//
[Tue Oct 11 13:23:53 2011] Checking for Bowtie index files
[Tue Oct 11 13:23:53 2011] Checking for reference FASTA file
[Tue Oct 11 13:23:53 2011] Checking for Bowtie
Bowtie version: 0.12.7.0
[Tue Oct 11 13:23:53 2011] Checking for Samtools
Samtools Version: 0.1.18
[Tue Oct 11 13:23:53 2011] Generating SAM header for 
/home/zohra/indexes_bowtie/humain_
[Tue Oct 11 13:23:55 2011] Preparing reads
format: fastq
quality scale: phred33 (default)
[FAILED]
Error running 'prep_reads'
Error: qual length (51) differs from seq length (51) for fastq record !

Can you help me.
Thanks
Zohra Saci





  ___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] version tophat and cufflinks

[graham etherington (TSL)]

Hi Dongdong,
The version of TopHat is 1.2.0 and Cufflinks is 1.0.1.
The full list of all Galaxy dependencies can be found on the wiki at:
http://wiki.g2.bx.psu.edu/Admin/Tools/Tool%20Dependencies

All the best,
Graham

Dr. Graham Etherington
Bioinformatics Support Officer,
The Sainsbury Laboratory,
Norwich Research Park,
Norwich NR4 7UH.
UK
Tel: +44 (0)1603 450601

From: dongdong zhaoweiming 
mailto:zhaoweiming1...@yahoo.com.cn>>
Date: Mon, 10 Oct 2011 17:57:51 +0100
To: "galaxy-user@lists.bx.psu.edu" 
mailto:galaxy-user@lists.bx.psu.edu>>
Subject: [galaxy-user] version tophat and cufflinks

Hi,

May I ask what is the version of TopHat and cufflinks in the galaxy?
Thanks a lot!
weimin zhao


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Q about 'Compute' tool

[Ian Donaldson]

Thank Russell for the tip, it was just what i needed.  Is there a explanation 
of how to construct the instructions for 'Compute' somewhere?  I have not been 
able to find it.

Also thanks to Hans-Rudolf.

Ian

From: Russell Bell [russell.b...@hci.utah.edu]
Sent: 10 October 2011 18:16
To: galaxy-user@lists.bx.psu.edu; Ian Donaldson
Subject: Re: [galaxy-user] Q about 'Compute' tool

Ian,

using your
chr15001000geneA.+
chr120002500geneB.-

problem i was able to get

chr15001000geneA.+ 500.0
chr120002500geneB.- 2500.0

Using

c2 if c6=='+' else c3

in the Compute tool.  See if it works for you.

-
Russell



>Date: Mon, 10 Oct 2011 17:36:58 +0200
>From: Hans-Rudolf Hotz 
>To: Ian Donaldson , Daniel Blankenberg
>,   "galaxy-user@lists.bx.psu.edu"
>
>Subject: Re: [galaxy-user] Q about 'Compute' tool
>Message-ID: <4e93111a.4060...@fmi.ch>
>Content-Type: text/plain; charset=ISO-8859-1; format=flowed
>
>
>
>On 10/10/2011 04:45 PM, Ian Donaldson wrote:
>> Thanks, but not quite what i need.
>>
>> If i start with two intervals:
>> chr15001000geneA.+
>> chr120002500geneB.-
>>
>> I want to add via, e.g. 'Compute', the TSS position to the end of each
>>line.  The desired result being:
>>
>> chr15001000geneA.+500
>> chr120002500geneB.-2500
>>
>> This is because geneA is on the '+' strand and geneB is on the '-'
>>strand.
>>
>
>Hi Ian
>
>Have you tried
>
>"Filter and Sort"-> "Filter" data on any column using simple expressions
>
>and create two lists containing all genes on the '+' strand and alles
>genes on the '-' strand.
>
>followed by
>"Text Manipulation"-> "Cut" columns from a table
>
>   using 'c1,c2,c3,c4,c5,c6,c2' for the list with all genes on the '+'
>strand
>
>   and
>
>   using 'c1,c2,c3,c4,c5,c6,c3' for the list with all genes on the '-'
>strand
>
>
>and then you can create a single list again with
>
>"Text Manipulation"-> "Concatenate" datasets tail-to-head
>
>
>I guess this is waht you want, isn't-it?
>
>
>Regards, Hans
>
>
>> Thanks,
>> Ian
>> 
>> From: Daniel Blankenberg [d...@bx.psu.edu]
>> Sent: 10 October 2011 14:34
>> To: Ian Donaldson
>> Cc: galaxy-user@lists.bx.psu.edu
>> Subject: Re: [galaxy-user] Q about 'Compute' tool
>>
>> Hi Ian,
>>
>> Under Operate on Genomic Intervals, you can try the "Get Flanks" tool;
>>you can request upstream, downstream, or both of your provided regions.
>>Please let us know if you need additional assistance.
>>
>>
>> Thanks for using Galaxy,
>>
>> Dan
>>
>>
>> On Oct 10, 2011, at 6:35 AM, Ian Donaldson wrote:
>>
>> Hi,
>>
>> Can 'if' statements by used in 'Text manipulation'>  'Compute'?
>>
>> The reason is that i have a interval file of UCSC genes, i want to
>>identify the TSS of each and make a new interval reflecting the TSS
>>position for each gene.  But because the TSS of a '-' stranded gene is
>>actually the 'end' coord i want to be able to check the strand in the
>>compute statement.
>>
>> Is this possible or is there an easier way to do this inside GALAXY?
>>
>> Thank you,
>> Ian
>> ___
>> The Galaxy User list should be used for the discussion of
>> Galaxy analysis and other features on the public server
>> at usegalaxy.org.  Please keep all replies on the
>>list by
>> using "reply all" in your mail client.  For discussion of
>> local Galaxy instances and the Galaxy source code, please
>> use the Galaxy Development list:
>>
>>   http://lists.bx.psu.edu/listinfo/galaxy-dev
>>
>> To manage your subscriptions to this and other Galaxy lists,
>> please use the interface at:
>>
>>   http://lists.bx.psu.edu/
>>
>>
>>
>>
>>
>> ___
>> The Galaxy User list should be used for the discussion of
>> Galaxy analysis and other features on the public server
>> at usegalaxy.org.  Please keep all replies on the list by
>> using "reply all" in your mail client.  For discussion of
>> local Galaxy instances and the Galaxy source code, please
>> use the Galaxy Development list:
>>
>>http://lists.bx.psu.edu/listinfo/galaxy-dev
>>
>> To manage your subscriptions to this and other Galaxy lists,
>> please use the interface at:
>>
>>http://lists.bx.psu.edu/
>
>
>--
>
>___
>galaxy-user mailing list
>galaxy-user@lists.bx.psu.edu
>http://lists.bx.psu.edu/listinfo/galaxy-user
>
>
>End of galaxy-user Digest, Vol 64, Issue 9
>**


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at useg