Re: [galaxy-user] Galaxy User List Being Retired on June 6, 2014.
I think this is great. Do we have it clearly explained on the wiki somewhere about how to turn on mailing list mode within biostar? I didn’t see anything in a quick search, but it would probably help ease the transition for people that just love the mailing list approach. I also find it incredibly useful just for following new posts. Thanks, Dan On May 30, 2014, at 12:47 PM, Dave Clements cleme...@galaxyproject.org wrote: Hello all, In case you didn't see this it the June Galaxy Newsletter that went out today: Galaxy-User Being Retired June 6 Join the conversation! Learn how here. The Galaxy Biostar online forum was launched April 23 as a replacement for the Galaxy-User mailing list. During the past 5 weeks, Galaxy Biostar has been wildly successful with over 125 active threads, more than 5 times the number of active threads on Galaxy-user in the 5 weeks before the switch. Galaxy-User has remained open during the transition, but now it's time to retire it. All new posting to Galaxy-User will be stopped on Friday, June 6, some 101 months, and 8,100 postings after it was launched. All those postings will remain available both in Galaxy Biostar (where they have been imported), and in the online list archives. Thanks for making Galaxy Biostar, and Galaxy-User before it, such a great resource. Thanks again, Dave C -- http://galaxyproject.org/GCC2014 http://galaxyproject.org/ http://getgalaxy.org/ http://usegalaxy.org/ https://wiki.galaxyproject.org/ ___ The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/ Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/ Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Base Recalibration tool on usegalaxy
Hi Kaz, The issue with the Table Recalibration tool should now be resolved, you’ll need to refresh your Galaxy window if you haven’t already. Thanks for reporting the error and let us know if you find any more issues. Thanks for using Galaxy, Dan On Apr 12, 2014, at 2:27 AM, KS k...@kyudai.jp wrote: Hi Dan, Thank you for informing. I know I should install my own local galaxy server for repetitive analyses, but this is the first time for me to analyse exome. Thank you for giving me opportunity to use galaxy in public. Hoping recovery of Table Recalibration tool. Regards, Kaz 2014-04-12 13:08 GMT+09:00 Daniel Blankenberg d...@bx.psu.edu: Hi Kaz, We do have a problem with the Table Recalibration tool on Main right now. We'll let you know when we have a fix. Thanks for using Galaxy, Dan On Apr 11, 2014, at 10:24 PM, KS k...@kyudai.jp wrote: Hi Bjoern, Thank you for the reply. I found Table Recalibration, probably from GATK, on Tool Shed as you informed. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=nameadvanced_search=falseoperation=view_or_manage_repositorypage=1async=falseshow_item_checkboxes=falsef-free-text-search=recalibrationid=797c55906a13241a But I am only a user of usegalaxy public server, so I am afraid I think I can't install tool from tool shed. What I am doing is here: https://usegalaxy.org/u/ksfk/h/illumina-exome I think I need Table Recalibration in NGS: GATK Tools (beta) tool group of left pane of usegalaxy, but I cannot find it. I am wondering whether there is any way to directly call Table Recalibration without web-application wrapper. Regards, Kaz 2014-04-12 7:26 GMT+09:00 Björn Grüning bjoern.gruen...@gmail.com: Hi Kaz, you are searching for GATK tools, right? Please have a look at the GATK suites in the Tool Shed. Cheers, Bjoern Am 12.04.2014 00:16, schrieb KS: Dear all, I can't find either of Table Recalibration or Base Recalibrator on usegalaxy public server. I am defident this is right place to ask, but seqanswers is clouded with many other pipelines. Is there an update of base recalibration tool on usegalaxy? Best, Kaz ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Base Recalibration tool on usegalaxy
Hi Kaz, We do have a problem with the Table Recalibration tool on Main right now. We’ll let you know when we have a fix. Thanks for using Galaxy, Dan On Apr 11, 2014, at 10:24 PM, KS k...@kyudai.jp wrote: Hi Bjoern, Thank you for the reply. I found Table Recalibration, probably from GATK, on Tool Shed as you informed. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=nameadvanced_search=falseoperation=view_or_manage_repositorypage=1async=falseshow_item_checkboxes=falsef-free-text-search=recalibrationid=797c55906a13241a But I am only a user of usegalaxy public server, so I am afraid I think I can't install tool from tool shed. What I am doing is here: https://usegalaxy.org/u/ksfk/h/illumina-exome I think I need Table Recalibration in NGS: GATK Tools (beta) tool group of left pane of usegalaxy, but I cannot find it. I am wondering whether there is any way to directly call Table Recalibration without web-application wrapper. Regards, Kaz 2014-04-12 7:26 GMT+09:00 Björn Grüning bjoern.gruen...@gmail.com: Hi Kaz, you are searching for GATK tools, right? Please have a look at the GATK suites in the Tool Shed. Cheers, Bjoern Am 12.04.2014 00:16, schrieb KS: Dear all, I can't find either of Table Recalibration or Base Recalibrator on usegalaxy public server. I am defident this is right place to ask, but seqanswers is clouded with many other pipelines. Is there an update of base recalibration tool on usegalaxy? Best, Kaz ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Can not delete data from my local galaxy
Hi Nishant, In your universe_wsgi.ini file, you need to set: allow_user_dataset_purge = True Thanks for using Galaxy, Dan On Apr 10, 2014, at 8:09 AM, Nishant THAKUR tha...@ciml.univ-mrs.fr wrote: Hello, I am using local galaxy server. I have disc storage problem and I noticed that galaxy is utilizing most of the space. I deleted old projects permanently, but they are appearing again in the saved history with one message which says datasets were not removed from disk because that feature is not enabled in this Galaxy instance. Any suggestions how to enable this feature or delete dataset permanently from history. Galaxy installed on ubuntu 12.04 LTS, 3.5.0-44-generic, 64bit. Best regards Nishant Thakur ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] How do I remove Histories shared with you by others?
Hi Casey, I was able to confirm this issue and we’ll work on a fix for it. Thanks for reporting. Thanks for using Galaxy, Dan On Feb 6, 2014, at 10:25 AM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Casey, I just tested the UI unsharing for both of your cases and was unable to replicate the problem. Can you confirm that you are using the public Main Galaxy instance at http://usegalaxy.org ? And is this your account email? Please confirm and we can try to see what may be going on. For the other, prior, question you reference, that one was fully resolved and permissions were not a factor. The thread has a reply with a link to our sharing wiki/video. The UI is/was behaving as expected. To share/unshare, use the pull-down menus or use the forms available from the history menu. Let us know about where you are using Galaxy, and we can follow up with more testing, Thanks! Jen Galaxy team On 2/6/14 3:46 AM, Casey Bergman wrote: Hello - I am trying to clean out my Histories shared with you by others page on the main public Galaxy server. I would like to remove old histories shared with me. I have tried two methods, neither of which allow me to remove these histories: 1. clicking the check box to a history shared with me, then clicking Unshare at the bottom of the page 2. clicking the drop down menu and then selecting Unshare In both cases, I get the error message History is not owned by the current user. This behavior appears to be referenced in another recent thread from the sharer's side (http://user.list.galaxyproject.org/Trying-to-quot-unshare-quot-a-history-in-order-to-delete-td4656453.html). Any ideas on what is going on here? Best regards, Casey ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] [galaxy-dev] Connecting to new Galaxy Cloudman by FTP
Hey Mo, You can use ssh to connect to the Galaxy machine. If you used cloudlaunch to create your instance, it should display an example connection string that will work from e.g. a linux/mac shell, something like: 'ssh -i cloudman_keypair.pem ubuntu@IP', after your instance launched. Once inside of the machine, you can do something like: 'sudo -iu galaxy', to switch to the galaxy user and then have a look at the mount points under /mnt/. The cloudman_keypair.pem file is the key file that you (should have) downloaded the first time that you launched a cloudman instance, or when you manually generated a keypair. You can create additional keypairs in your aws console if you need to download a new one to use (you can probably delete the existing cloudman_keypair and have it regenerated automatically by cloudman, but I haven't tested this and I wouldn't recommend doing this if an instance is running). You'll need to use the correct .pem file for the keypair that you specified during launch of the instance. See http://docs.aws.amazon.com/AWSEC2/latest/UserGuide/generating-a-keypair.html for Amazon's info on creating keypairs (especially if you are using e.g. Windows and putty: http://docs.aws.amazon.com/AWSEC2/latest/UserGuide/putty.html). Once you make the changes to the files locally, you can use the Cloudman Admin web UI to restart the Galaxy instance. Let us know if you encounter any issues. Thanks for using Galaxy, Dan On Jul 15, 2013, at 7:22 PM, Mohammad Heydarian wrote: Hey Nate, Thanks for the response and instructions. I understand the last three steps of your protocol, but the first step is difficult for me to understand. I'm guessing that, 1. Set 'use_pbkdf2 = False' in universe_wsgi.ini anywhere in the [app:main] section, is telling me to change a setting of Cloudman by command line. This is generally where we get stuck in using Cloudman, because we aren't familiar with command line (we get cold sweats and light palpitations) and are weary of making changes to the Cloudman code. I would ask our IT guys for help, but their expertise ends at updating Office tools. I would bother a programmer or bioinformatician, but most of them are so busy you need a formal collaboration to get on their radar. I would ask people who vaguely know command line for help, but most of the time their knowledge of command line is just higher than mine and we end up troubleshooting an issue neither of us can really grasp. So, is there a webcast, or video, or slideshow, that can show a newbie how to command line into Cloudman and make the changes you outline in step 1? Cheers, Mo Heydarian On Mon, Jul 15, 2013 at 4:22 PM, Nate Coraor n...@bx.psu.edu wrote: On Jul 8, 2013, at 3:50 PM, Mohammad Heydarian wrote: Hi, I am having trouble setting up a FTP connection with the recently released version of Galaxy Cloudman (ami-118bfc78). I have instantiated the new version of Galaxy Cloudman with CloudLaunch and also through the AWS EC2 wizard (using the same security group settings as the previous versions) and neither instance will connect to my FTP connection. Has anyone else had this problem? Does anyone know what is preventing the FTP connection? Any help would be greatly appreciated. Hey Mo, This may be a case of the new password hashing algorithm's incompatibility with the provided ProFTPD config. Could you try the following: 1. Set 'use_pbkdf2 = False' in universe_wsgi.ini anywhere in the [app:main] section 2. Restart Galaxy 3. Reset your password in the Galaxy UI 4. Test FTP again --nate Cheers, Mo Heydarian ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by
Re: [galaxy-user] Unable to use FASTQ tool on Main over several days
Hi Eduardo, I've committed some code that should fix the issue that you are experiencing, and it will be available on the main server after the next update (some time next week). Until then, if you change the name of e.g. your history item 34 to not have a 'í' or other non-ascii characters in it, you should be able to continue to use this history before the main server is updated. Please let us know if you encounter additional issues. Thanks for using Galaxy, Dan On May 24, 2013, at 10:31 AM, Eduardo Fox wrote: Please, I have been unable to use any of the tools under FASTQ Tools for the last 4 days. I keep getting an error message with codes, for instance GURU MEDITATION: #376b73ae417d41f3a7c2088770e13b8f. Is this part of the platform down for some reason? Best wishes and thanks, E. Fox ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] problem uploading txt data
Hi Chunyu, Thanks for reporting this issue, it has been resolved in our stable branch and will be available on our public server after the next update. Thanks for using Galaxy, Dan On May 12, 2013, at 10:52 AM, Chunyu Liu wrote: hi, I had an odd problem today, seems not a problem before: I am trying to upload a simple tab-delimited text file into galaxy, but it kept telling me: empty format: txt, database: hg19 The uploaded binary file contains inappropriate content Also, showed filesize as 0 bytes. I tried Unix format, DOS format. It is a very small data, only 348 bytes. 4 rows, as attached. What is WRONG? Thanks! Chunyu testData.txt___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Change format with edit attributes
Hi Gema, For example, see the Combine FASTA and QUAL into FASTQ tool for creating a FASTQ file from FASTA data; when quality data is not provided, fake score values will be used. Thanks for using Galaxy, Dan On Apr 3, 2013, at 10:42 AM, Peter Cock wrote: On Wed, Apr 3, 2013 at 3:40 PM, Gema Sanz Santos ge2sa...@gmail.com wrote: Hello, I'm trying to change the format to the output files from Barcode splitter from FASTA to FASTAQ so I can use them in Bowtie for Illumina. I've read that it can be done through the edit attributes, I go to datatype and select fastaq, save and then go to convert format and press convert but the resulting file is 0 bytes and is not recognized by Bowtie. I´ve also tried to upload by copying the link and selecting fastaq as format but in this case, I got the file shown in the picture and it is not recognized by Bowtie again. Screen Shot 2013-04-03 at 4.37.50 PM.png What can I do?? I don´t know how to continue because I´m not able to change the format to fastaq! Thank you very much for your help in advance Best, Gema Hi Gema, There seem to be several factors confusing you here. The screenshot shows FASTA data wrongly labelled as FASTQ. The Galaxy edit attributes does NOT actually edit the data. There are separate tools which can convert from one format to another, which gives you a new entry in the history (another green box on the right). You can convert from FASTQ to FASTA, but doing the opposite is not possible without inventing quality scores (e.g. give everything score 30). Does that help? Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Discrepancy between Intersect and Join
Hi Aaron, I just tested this small example and it reported one region as the result of the intersect: https://main.g2.bx.psu.edu/u/dan/h/aaron-quinlan-intersect-test-02-08-2013 Do you have a history available that you can share (privately if you desire) where you see the issue, and we'll take a look. Thanks for using Galaxy, Dan On Feb 8, 2013, at 10:23 AM, Aaron Quinlan wrote: Dear list, I have a student that found an unexplained discrepancy between the results produced by the Operate on Genomic Intervals (OGI) intersect operation versus the OGI join operation. In particular, we know for certain that there are exactly 1105 intersection of at least 1bp between the two files we are testing, as we have confirmed this with our own bedtools and the ucsc table browser. An example intersection (intersecting positions: 10012008 - 10012013): file 1: chr1 10012008100120215.6186 file 2: chr1 10011813100120135_Strong_Enhancer 0 + 1001181310012013250,202,0 However, OGI intersect find 0 intersections between the files (settings: return overlapping intervals, = 1bp). In an effort to make sure we didn't goof up on file formats (BED) or genome builds (hg19), we tested the exact same two files with the OGI join operation and found 1105 intersections as expected. I also tested the files with the bx-python bed_intersect.py and bed_intersect_basewise.py scripts and get the expected results. Does anyone have a suggestion for how to resolve this? Thanks for your help and for providing such a fantastic resource to the genomics community. Best, - Aaron quinlanlab.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Discrepancy between Intersect and Join
Hi Aaron, If you did this on our public main server, you can use the share options (gear icon in history list -- Share or publish), this will let us investigate a bit deeper into the exact problem/situation. If you were using a local instance (or the public server), then emailing them directly to me will work just fine. Thanks for using Galaxy, Dan On Feb 8, 2013, at 3:10 PM, Aaron Quinlan wrote: Hi Dan, Thanks for the follow up. Yes, I was also able to get it to work when I created a test case using the example I originally sent. Yet when I run the entire files, I get zero intersections. Join, in contrast, works fine. I'd be happy to share the files. Would it be best to send them directly to you by email? The are small. Thanks much for the help, - Aaron quinlanlab.org On Feb 8, 2013, at 2:56 PM, Daniel Blankenberg d...@bx.psu.edu wrote: Hi Aaron, I just tested this small example and it reported one region as the result of the intersect: https://main.g2.bx.psu.edu/u/dan/h/aaron-quinlan-intersect-test-02-08-2013 Do you have a history available that you can share (privately if you desire) where you see the issue, and we'll take a look. Thanks for using Galaxy, Dan On Feb 8, 2013, at 10:23 AM, Aaron Quinlan wrote: Dear list, I have a student that found an unexplained discrepancy between the results produced by the Operate on Genomic Intervals (OGI) intersect operation versus the OGI join operation. In particular, we know for certain that there are exactly 1105 intersection of at least 1bp between the two files we are testing, as we have confirmed this with our own bedtools and the ucsc table browser. An example intersection (intersecting positions: 10012008 - 10012013): file 1: chr110012008100120215.6186 file 2: chr110011813100120135_Strong_Enhancer 0 + 1001181310012013250,202,0 However, OGI intersect find 0 intersections between the files (settings: return overlapping intervals, = 1bp). In an effort to make sure we didn't goof up on file formats (BED) or genome builds (hg19), we tested the exact same two files with the OGI join operation and found 1105 intersections as expected. I also tested the files with the bx-python bed_intersect.py and bed_intersect_basewise.py scripts and get the expected results. Does anyone have a suggestion for how to resolve this? Thanks for your help and for providing such a fantastic resource to the genomics community. Best, - Aaron quinlanlab.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] How to display data at UCSC main?
Hi Anna, Thank you for reporting this error. There is currently an issue with displaying the link in the history item for the way we normally display interval datasets at UCSC. However, we have an alternative method available and I have enabled that for now. You will need to refresh the history pane and the link should appear for your datasets. Please let us know if you encounter additional issues. Thanks for using Galaxy, Dan On Dec 21, 2012, at 11:58 AM, Jennifer Jackson wrote: Hello Anna, Are you still having this issue? Are you running the tutorial on the public Main instance at http://main.g2.bx.psu.edu (usegalxy.org)? Please give it another check (our server was recently updated) and if the problem is persistent, share you history with me and I can take a look. To share from the public Main server: while this history is active, at the top of History panel use Options (gear icon) - Share or Publish, then generate a share link, copy it, and paste into a return email. Note the dataset that you believe is the one for this step and that should have the link, but does not, and I can provide feedback. Hopefully you have worked this out, but if not we can help, Jen Galaxy team On 12/19/12 7:04 AM, Anna Vilborg wrote: Dear mailing list, I am new to Galaxy and am going through the tutorials, starting with Galaxy 101. Under point 2.5. Recovering exon info and displaying data in genome browsers in the tutorial, there is the option to display data at UCSC. However, I don't have this option, although my history looks otherwise identical to the tutorial one (I am using hg19 as does the tutorial). I can display my data at Ensembl. Does anyone now why I don't get the UCSC option? Best Regards Anna Vilborg ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Umar,
Can you click the eye icon to view the contents of the 'log' dataset for the
GATK run. The end of the log should have the actual error encountered (the text
you provided is a bit of a red herring)
Since you are using hg19, the most likely cause for the error is that the
reference fasta file you are using is not ordered properly, or that your
alignments were made using a different genome (e.g. alignment with bwa using
built-in hg19 [not ordered properly] and then GATK using a different hg19 fasta
from your history.)
If you are using a custom genome, make sure that it is GATK-ordered and that
the same one is used in all steps; there is an hg19 GATK-ordered fasta file
available in a Data library ('GATK') on Main.
Thanks for using Galaxy,
Dan
On Dec 11, 2012, at 12:11 PM, Farooq,Umar (res) wrote:
Hi,
I am trying to incorporate GATK in my pipeline but not been able to make it
work. I aligned my data with Hg 19 and then ran sam tool filter and then
picard duplicate removal. I uploaded dbSNP and the reference FASTA file for
Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base
recalibration will not accept this output file. I wonder if there is sorting
or indexing issue but how to fix this in galaxy.
An error occurred running this job: Picked up _JAVA_OPTIONS:
-Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012]
net.sf.picard.sam.CreateSequenceDictionary
REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta
OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp
Thanks,
Umar
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Philippe, The GATK wrappers provided with the Galaxy distribution are for GATK version 1.4. There is a set of 1.6/GATK-lite wrappers that has been developed by the team, but is not yet available. There may also be other options available in the Tool Shed that have been contributed by the community. Thanks for using Galaxy, Dan On Dec 11, 2012, at 5:26 PM, Philipe Moncuquet wrote: Hi, I have encountered the same kind of errors. When I update the loc files link to GATK, some of the tools display the reference genomes I added and some not. It seems that the galaxy wrapper for GATK 1.6 is not very functional. GATK don't really care because they are not supporting it any more, even documentation has disappeared. And I understand that galaxy developers have other stuff to do than supporting a tool that will disappear because it's not open source any more. I don't know what tool could replace the recalibration process done by GATK and don't know how to correct bugs neither. Any suggestions ? Philippe 2012/12/12 Farooq,Umar (res) ufar...@resident.uchc.edu Hi, I am trying to incorporate GATK in my pipeline but not been able to make it work. I aligned my data with Hg 19 and then ran sam tool filter and then picard duplicate removal. I uploaded dbSNP and the reference FASTA file for Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base recalibration will not accept this output file. I wonder if there is sorting or indexing issue but how to fix this in galaxy. An error occurred running this job: Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp Thanks, Umar ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK Not running
Hi Joshua, Is this on the main public site? If so, can you share your history with me and I'll take a look? If this is on a local instance, can you provide additional information, such as the GATK version that you are using? Thanks for using Galaxy, Dan On Dec 11, 2012, at 5:34 PM, Joshua Orvis wrote: I'm having some problems with GATK as well, but do have a functional pipeline that uses the following GATK tools in Galaxy: - Realigner Target Creator - Indel Realigner - Unified Genotyper - Variant Filtration The main problem I'm having with them is that it seems I need to run the fasta/fastq groomer on all inputs before starting, and if I attempt to use the 'advanced' options on either of the last two steps above it fails immediately every time with a command-line option parsing error. I plan on digging into the wrapper script in the coming days in an attempt to correct this, which is currently attributed to Dan Blankenberg. I'm relatively new to Galaxy development though and don't know where to submit my updates though should I fix any of these problems. Joshua On Tue, Dec 11, 2012 at 4:26 PM, Philipe Moncuquet philippe.m...@gmail.com wrote: Hi, I have encountered the same kind of errors. When I update the loc files link to GATK, some of the tools display the reference genomes I added and some not. It seems that the galaxy wrapper for GATK 1.6 is not very functional. GATK don't really care because they are not supporting it any more, even documentation has disappeared. And I understand that galaxy developers have other stuff to do than supporting a tool that will disappear because it's not open source any more. I don't know what tool could replace the recalibration process done by GATK and don't know how to correct bugs neither. Any suggestions ? Philippe 2012/12/12 Farooq,Umar (res) ufar...@resident.uchc.edu Hi, I am trying to incorporate GATK in my pipeline but not been able to make it work. I aligned my data with Hg 19 and then ran sam tool filter and then picard duplicate removal. I uploaded dbSNP and the reference FASTA file for Hg 19 in galaxy to run this pipeline. But for some reason GATK tool for base recalibration will not accept this output file. I wonder if there is sorting or indexing issue but how to fix this in galaxy. An error occurred running this job: Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/space/g2main [Mon Dec 10 10:30:42 EST 2012] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/space/g2main/tmp-gatk-tKp41A/gatk_input.fasta OUTPUT=/space/g2main/tmp-gatk-tKp41A/dict3503196447953523717.tmp Thanks, Umar ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Warning message
Hi Rolando, You'll need to remove the old blast datatypes from your datatypes_conf.xml file. If you haven't added any new datatypes manually yourself, you can copy the datatypes_conf.xml.sample file over of your datatypes_conf.xml file. Also, in the future questions about local Galaxy instances should be sent to the galaxy-dev mailing list. Thanks for using Galaxy, Dan On Nov 12, 2012, at 10:31 PM, Rolando Mantilla wrote: I'm having issues with the FASTQ_Groomer. What I have done it first I downloaded an SRA file created by an Ion torrent sequencer from the NCBI site. Then used the fastq-dump app from the NCBI site to covert the .sra file to .fastq file. When I uploaded the data into galaxy it recognized it as a fastq(as it should) but when I try to run the FASTQ groomer I get the message and warnings below. I also have already downloaded the the blast_datatypes tool from the tool_shed. I truly don't know what the issue is, any help An error occurred running this job: Groomed 12376 sanger reads into sanger reads. WARNING:galaxy.datatypes.registry:Error loading datatype with extension 'blastxml': 'module' object has no attribute 'BlastXml' WARNING:galaxy.datatypes.registry:Overriding conflicting datatype with extension 'blastxml', using datatype from /mnt/galaxyData/tmp/tmpdP_cZ7. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Error message on local install
Hi Chris, Are you able to share a copy of the offending file? Perhaps by uploading to the public Galaxy server, possibly trying the Grooming step there, and then sharing the history with me or by using the bug report option on the Grooming step if it fails? If not, you could look at the output created (the error dataset) and use e.g. tail to find out the last few fastq blocks that were successfully processed or wc -l to find out the number of lines written, and then use grep -C or a combination of head/tail to look at the original file and see if anything is amiss. Thanks for using Galaxy, Dan On Oct 10, 2012, at 6:28 PM, Chris Merrikh wrote: Hi, I'm trying to solve an issue I'm having with my local installation of Galaxy (installed on my own computer, rather than on a server). I'm using data in the form of fastq files from an Illumina Hi-seq and I want Galaxy to parse the bar coded sequences out into individual files for me. I've been using the public server in the past, and I'm able to use the Groomer, Joiner, Reverse-Complement, Trimmer, and Barcode Splitter tools just fine. Now I'm trying to do the same thing locally on the same files. Both the large file (38 GB) and a smaller file consisting of the first 10k lines will upload just fine. However, I can only get the Groomer to work on the small file. When I use it on the large file I get an error: Error executing tool: maximum recursion depth exceeded while calling a Python object. Any help on this would be greatly appreciated! - Chris M. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] job information on galaxy
Hello, Thanks for reporting this error. This has been fixed in changesets 7875:62b89df24ab1 through 7879:046634d05007 in galaxy-central and will be included in the next distribution and main update. Please let us know if you encounter additional issues after the update. Thanks for using Galaxy, Dan On Oct 11, 2012, at 4:23 AM, i b wrote: Hi, I am trying to open the i icon on galaxy to look at the information of each job, but this does not opne for old jobs, only the last recent one ... Any suggestion? Thanks, ib ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Problem setting up admin in Galaxy local instance!
Hi Di, You need to remove the starting comment/hash from the admin_users line: admin_users = dkngu...@uw.edu Thanks for using Galaxy, Dan On Jul 20, 2012, at 5:13 PM, Di Nguyen wrote: Dear all, Please help me figure out what went wrong to set up ADMIN in my local instance using the new retinaMBP! This is what I did 1. I changed universe_wsgi.ini.sample file into universe_wsgi.ini (using Mac TextEdit) 2. Then, I edited universe_wsgi.ini as followed: # Administrative users - set this to a comma-separated list of valid Galaxy # users (email addresses). These users will have access to the Admin section # of the server, and will have access to create users, groups, roles, # libraries, and more. For more information, see: # http://wiki.g2.bx.psu.edu/Admin/Interface #admin_users = dkngu...@uw.edu 3. I shutdown Galaxy, rerun sh run.sh, log back in Galaxy but still no Admin function. 4. The reason that I wanted to ad Admin function is to import my NGS files (bigger than 2Gb fer sure) into Galaxy database. Please give me some tips on this as well. Thank you very much, Di Nguyen, postdoc U of Washington, Seattle, WA ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool
Hi Raj, This is currently available in -central (https://bitbucket.org/galaxy/galaxy-central), but will be available in the next dist release. You can pull directly from central, apply the changes manually, or wait for the next dist release. Thanks for using Galaxy, Dan On Mar 2, 2012, at 2:20 AM, Praveen Raj Somarajan wrote: Hello Dan, But, I am currently using the latest update of Galaxy (as 'hg incoming' says 'no changes'). Just to clarify one thing: which repository should I clone - https://bitbucket.org/galaxy/galaxy-dist/ (mentioned in GetGalaxy.org) OR http://www.bx.psu.edu/hg/galaxy/ (mentioned in NewsBrief website). I use the first one to update Galaxy. I tried to pull the below changeset, but it says 'invalid revision'. Please suggest. Best, Raj From: Daniel Blankenberg [mailto:d...@bx.psu.edu] Sent: Thursday, March 01, 2012 8:45 PM To: Praveen Raj Somarajan Cc: galaxy-user@lists.bx.psu.edu Subject: Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool Hi Raj, Thanks for reporting, this issue has been resolved in changeset 6778:35be930b21be. Please let us know if you encounter further issues. Thanks for using Galaxy, Dan On Mar 1, 2012, at 3:30 AM, Praveen Raj Somarajan wrote: Hello, I'm facing an issue with Depth Of Coverage tool when it runs on refGene and target BED file. The error message is: File cheetah_DynamicallyCompiledCheetahTemplate_1330588825_26_16118.py, line 402, in respond NotFound: cannot find 'omit_interval_statistics' while searching for 'gatk_param_type.omit_interval_statistics' I noticed that the issue is only when the Advanced GATK options is enabled to set target BED file. The commandline runs perfectly with the input files, but galaxy fails due to this error. Can anyone suggest what's the issue? Best, Raj This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely for the use of the addressee(s). If you are not the intended recipient, please notify the sender by e-mail and delete the original message. Further, you are not to copy, disclose, or distribute this e-mail or its contents to any other person and any such actions that are unlawful. This e-mail may contain viruses. Ocimum Biosolutions has taken every reasonable precaution to minimize this risk, but is not liable for any damage you may sustain as a result of any virus in this e-mail. You should carry out your own virus checks before opening the e-mail or attachment. The information contained in this email and any attachments is confidential and may be subject to copyright or other intellectual property protection. If you are not the intended recipient, you are not authorized to use or disclose this information, and we request that you notify us by reply mail or telephone and delete the original message from your mail system. OCIMUMBIO SOLUTIONS (P) LTD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely for the use of the addressee(s). If you are not the intended recipient, please notify the sender by e-mail and delete the original message. Further, you are not to copy, disclose, or distribute this e-mail or its contents to any other person and any such actions that are unlawful. This e-mail may contain viruses. Ocimum Biosolutions has taken every reasonable precaution to minimize this risk, but is not liable for any damage you may sustain as a result of any virus in this e-mail. You should carry out your own virus checks before opening the e-mail or attachment. The information contained in this email and any attachments is confidential and may be subject to copyright or other intellectual property protection. If you are not the intended recipient, you are not authorized to use or disclose this information, and we request that you notify us by reply mail or telephone and delete the original message from your mail system. OCIMUMBIO SOLUTIONS (P) LTD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu
Re: [galaxy-user] Error in DepthOfCoverage (GATK) tool
Hi Raj, Thanks for reporting, this issue has been resolved in changeset 6778:35be930b21be. Please let us know if you encounter further issues. Thanks for using Galaxy, Dan On Mar 1, 2012, at 3:30 AM, Praveen Raj Somarajan wrote: Hello, I'm facing an issue with Depth Of Coverage tool when it runs on refGene and target BED file. The error message is: File cheetah_DynamicallyCompiledCheetahTemplate_1330588825_26_16118.py, line 402, in respond NotFound: cannot find 'omit_interval_statistics' while searching for 'gatk_param_type.omit_interval_statistics' I noticed that the issue is only when the Advanced GATK options is enabled to set target BED file. The commandline runs perfectly with the input files, but galaxy fails due to this error. Can anyone suggest what's the issue? Best, Raj This e-mail contains PRIVILEGED AND CONFIDENTIAL INFORMATION intended solely for the use of the addressee(s). If you are not the intended recipient, please notify the sender by e-mail and delete the original message. Further, you are not to copy, disclose, or distribute this e-mail or its contents to any other person and any such actions that are unlawful. This e-mail may contain viruses. Ocimum Biosolutions has taken every reasonable precaution to minimize this risk, but is not liable for any damage you may sustain as a result of any virus in this e-mail. You should carry out your own virus checks before opening the e-mail or attachment. The information contained in this email and any attachments is confidential and may be subject to copyright or other intellectual property protection. If you are not the intended recipient, you are not authorized to use or disclose this information, and we request that you notify us by reply mail or telephone and delete the original message from your mail system. OCIMUMBIO SOLUTIONS (P) LTD ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Unable to run SICER or Find Peaks
Hi AP, Please keep all replies on list, this will allow the community to assist and benefit from these correspondences. SICER requires BED input. To go from BAM to BED: 1.) Convert BAM to SAM 2.) Convert SAM to Interval (Convert SAM to interval) 3.) Convert interval to BED(6+). This can be done by implicitly (by selecting the Interval dataset, which will be marked with '(as bed)' in the SICER input box) or by clicking on the pencil icon and explicitly converting uder the section Convert to new format. Please let us know if we can provide additional assistance. Thanks for using Galaxy, Dan On Nov 29, 2011, at 1:23 PM, Anupam Paliwal wrote: Hi Daniel, Thanks for your kind attention and advice. I have followed the following workflow: I aligned my query sequences to the reference genome using Bowtie; the Bowtie aligned SAM file was subjected to filter-SAM before converting it to BAM. I have re-BAM-to-SAM converted the BAM-file before subjecting it to pileup. However, now I do have the Input format file (after pileup of SAM) but am unable to convert it to BAM format to be able to submit it ti SICER. Please see if you can suggest how to convert the Input files back to BAM. I have tried changing directly through edit-attributes, but it shows error. AP Hi AP, SICER requires BED formatted input with at least 6 columns (for strand information). You can convert your BAM files into SAM and then into interval and BED format. Once you have your input in the BED (6+) format, you should be able to use these tools. Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Nov 23, 2011, at 12:26 PM, Anupam Paliwal wrote: Hi, I want to use SICER or Find Peaks for peak calling on GALAXY. I am using my aligned ChIP-seq tag .BAM files. However for both the tools the history is unable to pick the Bowtie-ligned SAM to BAM converted files. On the other hand, using MACS the same files are working nicely for peak calling. Thanks, AP ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Unable to run SICER or Find Peaks
Hi AP, SICER requires BED formatted input with at least 6 columns (for strand information). You can convert your BAM files into SAM and then into interval and BED format. Once you have your input in the BED (6+) format, you should be able to use these tools. Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Nov 23, 2011, at 12:26 PM, Anupam Paliwal wrote: Hi, I want to use SICER or Find Peaks for peak calling on GALAXY. I am using my aligned ChIP-seq tag .BAM files. However for both the tools the history is unable to pick the Bowtie-ligned SAM to BAM converted files. On the other hand, using MACS the same files are working nicely for peak calling. Thanks, AP ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Question regarding: FASTQ Quality Trimmer
Hi Rahul, This is the maximum number of bases which can have their score not included when calculating the result of the selected aggregation function. For example, if you had a 5 base window with scores of 5,5,2,5 and 5, set aggregation to min score with a specified value of 4, with the action of =: 0, for maximum number of bases to exclude, would trim 1, for maximum number of bases to exclude, would not trim Thanks for using Galaxy, Dan On Nov 23, 2011, at 11:27 PM, Rahul Kanwar wrote: Hello, I am running Galaxy locally and it has been performing flawlessly! I wanted to get more insight about this flag in the FASTQ Quality Trimmer program: Maximum number of bases to exclude from the window during aggregation Does it mean the number of 5' bases to exclude while the doing the trimming step [i.e. the sliding window starts this many bp after the read start] ? I would really appreciate if someone could shed more light on this. Thanks. regards, Rahul ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] GATK
Hi Franzi, You have one too many hg19 in there. The fields go like: unique_build_id dbkey display_name fasta_file_path valid_tool_suites so: hg19hg19hg19 /drive1/galaxy/reference/hg19/sam_index/hg19_ref.fa gatk But do note that these tool integrations are still undergoing active development. Please report bugs if you encounter any. Thanks for using Galaxy, Dan On Nov 16, 2011, at 6:29 PM, Metge, Franziska wrote: Dear happy users of Galaxy, We are running Galaxy locally. It's a very fine tool! By now everything works fine, except when I try to run any GATK program. I usually get this error message: # ERROR -- # ERROR A USER ERROR has occurred (version 1.3-14-g348f2db): # ERROR The invalid arguments or inputs must be corrected before the GATK can proceed # ERROR Please do not post this error to the GATK forum # ERROR # ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments. # ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki # ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa # ERROR # ERROR MESSAGE: The fasta file you specified (/tmp/tmpp0oxJu/hg19) does not exist. # ERROR -- my picard_index.loc line for the hg19 reference looks like this: hg19hg19hg19hg19 /drive1/galaxy/reference/hg19/sam_index/hg19_ref.fa gatk also the bam file I am submitting to GATK has the reference genome specified in it's attributes. Could please anyone help me. Thank you Franzi ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Genetrack-Indexer/PeakPredictor
Hi Steffi, GeneTrack should be working again on the Main server, thanks for reporting the error. For information on the inner workings of GeneTrack, you should consult the paper that you mentioned, along with http://genetrack.bx.psu.edu/ and you can additionally contact the GeneTrack author, who I've CC'd here. Thanks for using Galaxy, Dan On Nov 10, 2011, at 11:32 AM, Stefanie Ververs wrote: Hi everybody, I'm using the Genetrack-Peak-Predictor to predict nucleosome positions. I still have some questions: 1) Am I correct that the genetrack indexer seems to be down on the Public Galaxy Server? I get a server error, when I start it. (The Genetrack Browser doesn't work either; although I'm still not quite sure whether there are dependencies.) 2) By now, I know one paper on Genetrack - http://bioinformatics.oxfordjournals.org/content/24/10/1305.short and I found the following presentation slides: http://ged.msu.edu/angus/tutorials-2011/files/lecture-chipseq.pdf. Galaxy tells me to cite Blankenberg D, et al. In preparation. Is there additional information? It would be great to know how exactly the peak predictor works, but the slides give only a kind of overview, but of course no explaining and no details and the paper isn't that clear. Thanks, Steffi ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Genetrack-Indexer/PeakPredictor
I think in general you should make sure to cite the authors of the original publication in addition to Galaxy, the note in Galaxy should make this explicit. Absolutely agree, the citations are arguably the most important part. The GeneTrack paper citation is currently listed in the help for the tools at http://usegalaxy.org and in -central. Any place where a citation is missing is an error and will be corrected as soon as it is reported. Thanks for using Galaxy, Dan On Nov 10, 2011, at 12:55 PM, Istvan Albert wrote: Hello Everyone, Galaxy tells me to cite Blankenberg D, et al. In preparation. I think in general you should make sure to cite the authors of the original publication in addition to Galaxy, the note in Galaxy should make this explicit. Small tidbits that may be useful. There is a command line version for genetrack with its source code at: https://github.com/ialbert/chipexo this is a fork of my son's project while he rotated in a lab, he ported a number of tools including GeneTrack to a command line interface. Seems to work well but I have not ran it for large genomes. In the course that I teach the lectures covering ChipSeq analysis: 19, 20 and 21 cover the usage and principles of GeneTrack (among other topics) http://bcc.bx.psu.edu/courses/597D-2011/index-597D-2011.html best regards, Istvan On Thu, Nov 10, 2011 at 12:19 PM, Daniel Blankenberg d...@bx.psu.edu wrote: Hi Steffi, GeneTrack should be working again on the Main server, thanks for reporting the error. For information on the inner workings of GeneTrack, you should consult the paper that you mentioned, along with http://genetrack.bx.psu.edu/ and you can additionally contact the GeneTrack author, who I've CC'd here. Thanks for using Galaxy, Dan On Nov 10, 2011, at 11:32 AM, Stefanie Ververs wrote: Hi everybody, I'm using the Genetrack-Peak-Predictor to predict nucleosome positions. I still have some questions: 1) Am I correct that the genetrack indexer seems to be down on the Public Galaxy Server? I get a server error, when I start it. (The Genetrack Browser doesn't work either; although I'm still not quite sure whether there are dependencies.) 2) By now, I know one paper on Genetrack - http://bioinformatics.oxfordjournals.org/content/24/10/1305.short and I found the following presentation slides: http://ged.msu.edu/angus/tutorials-2011/files/lecture-chipseq.pdf. Galaxy tells me to cite Blankenberg D, et al. In preparation. Is there additional information? It would be great to know how exactly the peak predictor works, but the slides give only a kind of overview, but of course no explaining and no details and the paper isn't that clear. Thanks, Steffi ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Istvan Albert Associate Professor, Bioinformatics Pennsylvania State University http://www.personal.psu.edu/iua1/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] tool config file: multi-select for files?
Hi Uwe, Multiple selects for dataset inputs is not yet supported, but there is a ticket open on this issue, which you may follow if you like: https://bitbucket.org/galaxy/galaxy-central/issue/137/allow-multiple-true-in-input-param-fields We have not yet decided when-or-if we will be implementing this feature, but please feel free to add comments to the ticket. For now the best course of action is to use a repeat parameter. Thanks for using Galaxy, Dan On Oct 21, 2011, at 5:45 AM, Appelt, Uwe wrote: Dear all, My tool does accept multiple input-files, but there are normally bunches of them, so the repeat-syntax doesn't appear to be a good idea. Inspired from the workflow-engine-capability to accept multiple input files I wanted to do the same for my tool: param name=inputSeqFiles type=data format=fasta multiple=true ... / Problem: The above param-syntax causes Galaxy to caugh up an error message, as soon as I indeed select multiple files. Selecting single files works well. The, to actually access the list of selected files, I would expect the same syntax as for the repeat-tag case to work. What I am currently trying from within a configfile-section is something like this: #for $inputSeqFile in $inputSeqFiles ...do something with $inputSeqFile #end for Problem: Cheetah complains about $inputSeqFiles not being iterable. Any suggestions or ideas/alternatives to this setting? Thanks in advance and best regards, Uwe ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] bed12 format for stitching blocks given a set of coding exon intervals
Hi Amit, Without taking a look at your history, I'll have to make a guess. When you retrieve regions from UCSC, on the second step, right before you click Send query to Galaxy, make sure that you have Whole Gene selected under One record per, and that you are looking at a gene track and that the format was set to BED on the first page. Also be sure to Not include a track header. Thanks for using Galaxy, Dan On Oct 19, 2011, at 11:10 PM, Amit Indap wrote: Hi Galaxy, I am trying to stitch together MAF alignments for the coding sequence for a few genes of interest in Drosophila. I used UCSC to send the bed intervals of the coding exons of my gene and sent the output to Galaxy. But when I try and use the tool Stitch Gene blocks it complains that my bed is a bed3 and not a bed12. I'm a bit rusty with my browser skills, but how can I send my output to Galaxy as a bed12 format so I can stitch my MAF blocks together? Thanks for your help! Amit -- Amit Indap ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Patch for better FASTQ description handling
Hi Florent, Sorry for the delay. I did try the patch out shortly after you contributed it, but it caused the functional to fail. I was able to fix the issue and allow the existing tests to start passing, but I've been bogged down lately and haven't been able to perform a more thorough review of the code. If you could provide tests with files (e.g. for the tools affected) that test the new functionality, that would be a great help. The use of partition removes python compatibility for 2.5, although this is a lesser/non-concern. Also, I'm not entirely sold on having the Identifier line being parsed as identifier + space + description instead a single identifier line. This would mean that identifiers could not themselves contain spaces, but There is no standardization for identifiers (so they could technically have spaces?). Could two different reads be identified as Read A and Read B, but then would no longer be uniquely identifiable as each would then be identified as Read. If this added functionalilty were introduced as optional behavior (e.g. a user needs to click a checkbox on the tools to apply the id line splitting), these concerns can be mitigated. Peter, Florent, anyone else: I'd be very interested to hear your thoughts on the above, particularly in respect to know real-world data. For now, lets discount SRA data from this discussion. Thanks, Dan On Oct 19, 2011, at 5:00 AM, Peter Cock wrote: On Wed, Oct 19, 2011 at 4:53 AM, Florent Angly florent.an...@gmail.com wrote: I have had the chance to try the patch on several datasets and it looks good :) I reiterate my suggestion to pull the patch in galaxy-central. Best, Florent It looks sensible, although I would add a comment to the join method to say the description from read1 is taken (if the reads differ in their descriptions). Mind you, the whole module seems to lack docstrings ;) Are there any unit tests (not that Galaxy seems to insist on them)? Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Memory issues while using Galaxy
Hi Prashant, Have you set: use_debug = False use_interactive = False In your universe_wsgi.ini file? Thanks for using Galaxy, Dan On Oct 17, 2011, at 6:15 PM, prashant singh wrote: Hi We have installed Galaxy on a local machine (Mac pro 2 x 2.4 gHz quad core Intel Xeon with 32 GB RAM). We wish to use dynamic trimmer in order to trim the data and while downloading a groomed file from galaxy, it runs out of memory. Please advise. Sent from my iPhone ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Regarding perl script
Hi Shambhavi, It sounds like your tool_conf.xml file is malformed. Check that you have proper quotes and that the tag open and close are all correct, etc. There are several programs out there that can validate xml files for you, you may wish to try to validate your xml file with one of those. Thanks for using Galaxy, Dan On Oct 18, 2011, at 12:23 AM, Shambhavi Srivastava wrote: Hello all, I am a new to GALAXY and am trying to create my own workflow with my own scripts written in PERL and integrating it with few already available in GALAXY. I tried the basic example given in GALAXYwiki..the program about counting GC content. I followed all the steps mentioned but when I start my galaxy server I dont see myTools option and even the pre installed options like GetData and all dont appear on screen. What should I do...can anyone send me another or a step by step procedure of how can I run my programs. Thankss.. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Chip-Seq, Encode Peaks and Galaxy
Hi Rad, Jorge, Sorry for the delay in reply. We have not yet released a pre-canned workflow to do this. However, if you are looking to associate one set of Genomic interval/region data with another set, Galaxy's interval operation tools are a good place to begin. There are good examples of using these tools available through screencasts (http://galaxycast.org), Galaxy 101 (http://usegalaxy.org/galaxy101), as well as the wiki (http://wiki.g2.bx.psu.edu/Learn/Interval%20Operations). Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Jun 23, 2011, at 9:41 AM, Radhouane Aniba wrote: Thanks Jennifer Rad 2011/6/23 Jorge Andrade andrade.jo...@gmail.com Please keep me on the loop as I am also interested in similar workflow. Many thanks and best regards, Jorge On Thu, Jun 23, 2011 at 3:21 AM, Jennifer Jackson j...@bx.psu.edu wrote: Hello Rad, Dan will be able to help you get started and build up a workflow for your analysis. He is currently on vacation, but will be returning soon and will contact you directly when he returns. We are very sorry about the delayed reply. Please know that we definitely want to help you to use Galaxy for your project, We will be in touch, Best, Jen Galaxy team On 6/17/11 10:55 AM, Radhouane Aniba wrote: Hi everyone, I have a list of genomic regions with some variants and would like to study the correlation between theses variants and epigenomics marks such as histone modifications. From Encode download page, i got some files corresponding to peaks of these hsitone modifications and would like to know if there is a way to create a pipeline using galaxy to map my variants, depending on genomic regions to the information I have from the histone modification peaks. Is there someone who can point me to a step by step to do things to start using Galaxy ? Thank you Rad ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org/ http://galaxyproject.org/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Radhouane Aniba Bioinformatics Postdoctoral Research Scientist Institute for Advanced Computer Studies Center for Bioinformatics and Computational Biology (CBCB) University of Maryland, College Park MD 20742 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] wiggle file
Hi Rich, Sorry for the delay in reply. You can configure the display of custom tracks at UCSC by clicking on the custom track within the UCSC genome browser. You can also convert your wig file to a bigwig file (under Convert Formats tool menu), in order to speed up the display of this data. For help with configuring custom tracks that you have loaded into the UCSC Genome Browser, please contact the UCSC Genome Browser team. Please let us know if we can provide additional information. Thanks for using Galaxy, Dan On Jul 5, 2011, at 5:48 PM, Richard Mark White wrote: Hi, this should be simple but it is not..forgive the newbie question. i am doing chip-seq. bowtiesam filter for mapped readsMACS. i want to create a wiggle file that displays in ucsc, but when i choose the WIG option on macs, and then try to show it in UCSC, it treats each line of the created WIG file as a separate track, and obviously does not show it as a graph. is there a wiki page somewhere that can give me the basics? or can someone point me in the right direction? thanks. rich ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] history
Hi Tania, In the History pane, Click 'Options' -- 'Saved Histories' and see if your history is listed there. Thanks for using Galaxy, Dan On Mar 24, 2011, at 12:15 PM, Fuchs, Tania wrote: Hello, I worked on my home computer with Galaxy online and next day when I came to the lab I hoped to be able to access everything I did at home through history, but it does not show up in history. I was logged in both times into my account. What did I do wrong? Thanks! Tania ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] FASTQ to FASTQSanger using Groomer question
Hi David,
Your files appear to be of the Sanger FASTQ variant. As you have noticed, the
info blurb provided by the Grooming tool provides information that should be
utilized to confirm input types. While the 'Illumina 1.3+' FASTQ format does
encode scores using a different ASCII range, it is my understanding that the
scripts provided by the manufacturer to create FASTQ formatted files were
enhanced to write out Sanger encoded quality scores.
The correct Grooming path for your data is Sanger -- Sanger. Please let us
know if we can provide further assistance.
Thanks for using Galaxy,
Dan
On Mar 21, 2011, at 9:42 AM, David K Crossman wrote:
Hello!
I am fairly new to using Galaxy and have a question about the
FASTQ Groomer feature. I have 4 RNA-Seq raw data files that were just
recently generated from Illumina’s NGS instruments. I am aware that the
first step to perform in Galaxy is FASTQ Groomer to convert the format to
FASTQ Sanger. I presume that I would choose Illumina 1.3+ in the “Input
FASTQ quality scores type” box. However, if I look at the raw data reads, I
notice that Line 4 (which encodes the quality values for sequence in Line 2)
has values outside of the Illumina 1.3+ range (some of them fall into the
Sanger format. I am enclosing the Quality Score Comparison figure along with
some of the raw RNA-Seq data):
Quality Score Comparison
SS
...III
..
!#$%'()*+,-./0123456789:;=?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| ||| |
|
3359 64 73104
126
S - Sanger Phred+33, 93 values (0, 93) (0 to 60 expected in raw reads)
I - Illumina 1.3 Phred+64, 62 values (0, 62) (0 to 40 expected in raw reads)
X - Solexa Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw
reads)
Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
RNA-Seq raw data
@HWI-ST156_294:7:1:1058:2165:0/1
CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC
+
FGGHHHGFHHFHHEGHCGGGEB.EE9D?DD4FFFCBB/.C=D
@HWI-ST156_294:7:1:1184:2191:0/1
CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG
+
EE;E=ECEEBE@=GBFGF/GFFCFA;:@8AEABBA#
@HWI-ST156_294:7:1:1018:2200:0/1
NCTGATTAAGGATAATGAGTAGTAGAACTAATGATGTTATTCCTTGG
+
###
@HWI-ST156_294:7:1:1225:2217:0/1
GTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA
+
FFCEFFFE?FEBDC?987::,3:-9145,DA:C9;+?
As a test in FASTQ Groomer, I chose either the Sanger or
Illumina 1.3+ as the input quality scores type and these are the results I
got:
FASTQ Groomer on tn-read1 (using Sanger as input)
6.1 Gb
format: fastqsanger, database:mm9
Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and
sequence, the input data is valid for: sanger Input ASCII range: '#'(35) -
'I'(73) Input decimal range: 2 - 40
FASTQ Groomer on tn-read1 (using Illumina1.3+ as input)
6.1 Gb
format: fastqsanger, database:mm9
Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality
and sequence, the input data is valid for: sanger Input ASCII range: '#'(35)
- 'I'(73) Input decimal range: -29 - 9
Which one is right (I presume the Illumina 1.3+ one, but I can’t find any
sort of explanation)? I noticed that the “input decimal range” had different
values (although they spanned the same length) in relation to which input was
chosen. What would happen downstream in TopHat if Sanger was used instead of
Illumina 1.3+ for these files? Is there any other reading
material/websites/etc… out there that might help me better understand the
quality score and which to use? Any info/help would be greatly appreciated.
Thanks,
David
David K. Crossman, Ph.D.
Systems Biologist/Analyst/Statistician
Heflin Center for Genomic Science
University of Alabama at Birmingham
720 20th Street South
Kaul Room 420
Birmingham, AL 35294-0024
(205) 996-4045
(205) 996-4056 (fax)
David K. Crossman, Ph.D.
Heflin Center for Genomic Science
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this
Re: [galaxy-user] Galaxy on Cloud not recognizing .txt files as fastq
Hi Karl, Using the upload tool for https URLs was added in changeset 5220:425076fe5ea0. I am not sure when this will make it to the Cloud image, but meanwhile, if you can access the file without using ssl (just 'http'), you should be able to upload. If this is not the issue you are experiencing please let us know. Do not hesitate to contact us if you need further assistance. Thanks for using Galaxy, Dan On Mar 14, 2011, at 7:30 PM, karlerh...@berkeley.edu wrote: I changed the permission for the files to public (everyone can open/download), but this did not fix the problem. Also, to answer Dannon's question, I am entering the full path for these files, eg. https://s3.amazonaws.com/bucketname/xyz.txt From the screencasts I have watched, I noticed that fastq files uploaded (from an S3 bucket or from elsewhere) always had a .fastq extension. Not sure whether this is an issue for galaxy or not. Hi Karl, As a quick check, are the permissions for the S3 file set so anyone can read the file? That's required before Galaxy's upload tool will be able to access the file. Alternatively, if you don't want to set such loose permissions, you should be able to get a a signed URL for the given file using a Firefox extension S3Fox. Enis On Mon, Mar 14, 2011 at 4:40 PM, karlerh...@berkeley.edu wrote: Hello, I have been able to get Galaxy to instantiate on our Cloud account, and would like to use the NGS tools to trim and map Illumina libraries. However, when I tried to import .txt files (the data contained in these files are in fastq format) located in an S3 bucket, Galaxy did not recognize them as fastq data. I tried to import the files via the URL of the S3 bucket, and Galaxy just imported the actual name of the URL rather than the file itself. Do I need to change the extension of these .txt files to .fastq? Or have I gotten something wrong with respect to the location of the data in the S3 bucket? thanks for any help! karl ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Import data in RGenetics
Hi Sylvain, This issue has been fixed in changeset 5207:72d560d3e7fd and will be available the next time that the main server is updated, which should be within the next few weeks. Thanks for reporting this error and please let us know if we can provide additional assistance. Thanks for using Galaxy, Dan On Feb 3, 2011, at 6:05 PM, Sylvain Baulande wrote: Dear Ross, Thank you form your prompt answer. unfortunately I still get an error message which is : An error occurred running this job: A required composite data file was not provided (RgeneticsData.ped) I did exactly what you mentioned except that my ped and map files have been uploaded using the ftp procedure. Do you have any clues ? Thank you so much for your help, Sylvain 2011/2/3 Ross ross.laza...@gmail.com Hi, Sylvian, The plink/rgenetics lped and pbed (compressed) formats are special 'composite' Galaxy datatypes because the map and pedigree/genotype files need to be kept together correctly inside Galaxy. As a result, the upload tool requires that the file type be specified so all of the components can be properly uploaded and stored together. For example, to upload pbed data from your local desktop, choose 'Upload file' from the Get Data tools. When the upload form appears, the trick is that you *must* change the default 'Autodetect' in the first (filetype) select box to the specific rgenetics datatype - either 'pbed' as the format for compressed plink data (or 'lped' for uncompressed plink genotype data) as the very first step. Type the first few letters into the first box, and select the right one from the list that appears. Once this is done, you will see that the upload tool form will change to show three separate file upload inputs - one each for the plink xxx.bim xxx.bed and xxx.fam where xxx is the name you set when you ran plink to create the files, or for uncompressed linkage format two separate file upload inputs - the plink .ped and .map files. Now you can browse for the corresponding file for each input box from your local machine - be careful not to mix them up as the upload tool is unable to tell unfortunately. At the bottom of the form, I suggest you then change the genome build to the appropriate one (eg hg18 or hg19). Finally, I'd recommend that you change the 'metadata value for basename' (which will be the new dataset name) to something that will remind you what the data are - something more meaningful than the default 'rgenetics'. Click 'execute' to upload the data and create the new dataset in your history. Compressed (pbed) format is preferred so the upload is quicker. Note that some tools will autoconvert between lped and pbed so there is a delay the first time some tools are run on a new dataset. There are built in converters (use the pencil icon) also if you need them. I hope this helps - thanks for using Galaxy and Rgenetics - please let us know how you go and feel free to contact me if you have other questions. On Fri, Feb 4, 2011 at 6:20 AM, BAULANDE Sylvain 211527 Partnerchip sylvain.baula...@cea.fr wrote: dear Galaxy users, I would like to import genotyping data in Rgenetics and I can't succeed. I have ped file and map file, I try to import them in lped format but it didn't work ... Anybody with experience can help me to solve this issue ? Many thanks in advance, Best regards, Sylvain ___ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user -- Ross Lazarus MBBS MPH Associate Professor, HMS; Director of Bioinformatics, Channing Laboratory; 181 Longwood Ave., Boston MA 02115, USA. Tel: +1 617 505 4850 Head, Medical Bioinformatics, BakerIDI; PO Box 6492, St Kilda Rd Central; Melbourne, VIC 8008, Australia; Tel: +61 385321444 ___ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] FASTQ type change
Hi Stephen and Peter, This change is definitely possible, and because the SAM format specifies that its quality scores are phred scaled and ASCII offset of 33 (regardless of provided input) it shouldn't cause complications downstream. We'll add this to our todo list. I created a ticket: https://bitbucket.org/galaxy/galaxy-central/issue/471/allow-bowtie-mapper-to-accept-fastq that you can follow if you like. Thanks, Dan On Feb 10, 2011, at 1:42 PM, Peter Cock wrote: On Thu, Feb 10, 2011 at 6:34 PM, Stephen Taylor stephen.tay...@imm.ox.ac.uk wrote: On 10/02/2011 13:05, Peter Cock wrote: On Thu, Feb 10, 2011 at 12:49 PM, Stephen Taylor stephen.tay...@imm.ox.ac.uk wrote: I think you have but it doesn't help. :-) The issue is we get a lot of Illumina 1.3+ format FASTQ files and bowtie in Galaxy by default doesn't accept them although there is an option on the command line bowtie to read these. So I think the solution seems to be either hardwire the code in our local Galaxy instance to use the --solexa1.3-quals option or (probably more useful) put a drop down list in the web UI to allow the user to set the format of the fastq sequences on the bowtie tool. Not the best approach. I think you should update the XML to include the --solexa1.3-quals option if the Galaxy file format is fastqillumina, see for example (in the reverse situation) the -Q 33 option is only used on fastqsanger when calling the FASTX tools, e.g. https://bitbucket.org/galaxy/galaxy-central/src/default/tools/fastx_toolkit/fastx_clipper.xml That way the user must mark their FASTQ file type as usual (at upload time or via the pencil icon to edit the attributes), and then bowtie will be called appropriately. Ok. Cool. I didn't realise you could do that! Sounds like this should be added into the main release. It would save a lot of time/disk space instead of using Groomer. I agree. Maybe Dan can take care of it - I don't have bowtie setup on our local Galaxy (yet) so I wouldn't be able to test the proposed fix. In the long term however the Solexa/Illumina FASTQ formats are on their way out since CASAVA 1.8 will switch to the Sanger FASTQ encoding: http://seqanswers.com/forums/showthread.php?t=8895 Peter ___ galaxy-user mailing list galaxy-user@lists.bx.psu.edu http://lists.bx.psu.edu/listinfo/galaxy-user ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
