[kwin] [Bug 442947] Some text in the Overview effect is blurry
https://bugs.kde.org/show_bug.cgi?id=442947 Bharadwaj Raju changed: What|Removed |Added Status|ASSIGNED|RESOLVED Resolution|--- |FIXED --- Comment #3 from Bharadwaj Raju --- The drop shadow effect has been removed from the text, so this bug is fixed now. -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445677] New: Kwin crashes when switching windows using thumbnail switcher quickly
https://bugs.kde.org/show_bug.cgi?id=445677 Bug ID: 445677 Summary: Kwin crashes when switching windows using thumbnail switcher quickly Product: kwin Version: 5.23.3 Platform: openSUSE RPMs OS: Linux Status: REPORTED Keywords: drkonqi Severity: crash Priority: NOR Component: general Assignee: kwin-bugs-n...@kde.org Reporter: nishant@gmail.com Target Milestone: --- Application: kwin_x11 (5.23.3) Qt Version: 5.15.2 Frameworks Version: 5.88.0 Operating System: Linux 5.14.14-3-default x86_64 Windowing System: X11 Distribution: "openSUSE Tumbleweed" DrKonqi: 5.23.3 [KCrashBackend] -- Information about the crash: - What I was doing when the application crashed: I was writing some word document with 4 browser tab open and 2 spreadsheet opened and I was constantly switching between them. I was also switching between one activity to other to change tracks in Spotify. Suddenly Kwin crashed and Activity switching stopped working (Wallpaper was not changing, but I can see my apps changing, but there was no visual effect, furthermore the active application remained open even though activity changed) The crash can be reproduced sometimes. -- Backtrace: Application: KWin (kwin_x11), signal: Segmentation fault [KCrash Handler] #4 0x7f57430619c0 in QSGOpenGLAtlasTexture::AtlasBase::bind(QSGTexture::Filtering) (this=0x55ca5cb06ef0, filtering=QSGTexture::Linear) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/util/qsgopenglatlastexture.cpp:249 #5 0x7f574305db40 in QSGOpaqueTextureMaterialShader::updateState(QSGMaterialShader::RenderState const&, QSGMaterial*, QSGMaterial*) (this=0x55ca5bc580c0, state=..., newEffect=, oldEffect=0x0) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/util/qsgtexturematerial.cpp:112 #6 0x7f57430449f4 in QSGBatchRenderer::Renderer::renderMergedBatch(QSGBatchRenderer::Batch const*) (batch=, this=0x55ca5c81b400) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgbatchrenderer.cpp:3097 #7 QSGBatchRenderer::Renderer::renderMergedBatch(QSGBatchRenderer::Batch const*) (this=0x55ca5c81b400, batch=0x55ca5cebcb10) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgbatchrenderer.cpp:3026 #8 0x7f5743049fc5 in QSGBatchRenderer::Renderer::renderBatches() (this=this@entry=0x55ca5c81b400) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgbatchrenderer.cpp:4051 #9 0x7f574304a9b2 in QSGBatchRenderer::Renderer::render() (this=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgbatchrenderer.cpp:4363 #10 0x7f5743031fa0 in QSGRenderer::renderScene(QSGBindable const&) (bindable=, this=0x55ca5c81b400) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgrenderer.cpp:264 #11 QSGRenderer::renderScene(QSGBindable const&) (this=0x55ca5c81b400, bindable=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgrenderer.cpp:220 #12 0x7f574303245b in QSGRenderer::renderScene(unsigned int) (fboId=, this=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgrenderer.cpp:205 #13 QSGRenderer::renderScene(unsigned int) (this=, fboId=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/coreapi/qsgrenderer.cpp:192 #14 0x7f5743096f63 in QSGDefaultRenderContext::renderNextFrame(QSGRenderer*, unsigned int) (this=0x55ca5c9f6b50, renderer=0x55ca5c81b400, fboId=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/scenegraph/qsgdefaultrendercontext.cpp:228 #15 0x7f5743104d69 in QQuickWindowPrivate::renderSceneGraph(QSize const&, QSize const&) (this=0x55ca5c434a60, size=..., surfaceSize=...) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/items/qquickwindow.cpp:617 #16 0x7f5743191467 in QQuickRenderControl::render() (this=) at /usr/src/debug/libqt5-qtdeclarative-5.15.2+kde36-1.1.x86_64/src/quick/items/qquickrendercontrol.cpp:355 #17 0x7f5743ac28a3 in KWin::EffectQuickView::update() () at /lib64/libkwineffects.so.13 #18 0x7f5744b80043 in QtPrivate::QSlotObjectBase::call(QObject*, void**) (a=0x7ffe6252ff00, r=0x55ca5c7dbd40, this=0x55ca5c59b190) at ../../include/QtCore/../../src/corelib/kernel/qobjectdefs_impl.h:398 #19 doActivate(QObject*, int, void**) (sender=0x55ca5c78d110, signal_index=3, argv=0x7ffe6252ff00) at kernel/qobject.cpp:3886 #20 0x7f5744b7950f in QMetaObject::activate(QObject*, QMetaObject const*, int, void**) (sender=, m=m@entry=0x7f5744e1fc00 , local_signal_index=local_signal_index@entry=0, argv=argv@entry=0x7ffe6252ff00) at kernel/qobject.cpp:3946
[kwin] [Bug 445207] Integrate KRunner with KWin's Present Windows function (aka ExposeAll)
https://bugs.kde.org/show_bug.cgi?id=445207 Vlad Zahorodnii changed: What|Removed |Added Resolution|--- |FIXED Status|ASSIGNED|RESOLVED Latest Commit||https://invent.kde.org/plas ||ma/kwin/commit/195de46c9156 ||584afee3283c7efe97dd400244b ||c --- Comment #3 from Vlad Zahorodnii --- Git commit 195de46c9156584afee3283c7efe97dd400244bc by Vlad Zahorodnii. Committed on 18/11/2021 at 07:26. Pushed by vladz into branch 'master'. effects/overview: Use Milou for search results Based on user feedback, it will be great to have krunner functionality integrated in the overview/present windows effect. This change ports the overview effect to Milou for search results. With it, one can search for existing windows or launch new applications. M +56 -15 src/effects/overview/qml/ScreenView.qml M +3-43 src/effects/overview/qml/WindowHeap.qml https://invent.kde.org/plasma/kwin/commit/195de46c9156584afee3283c7efe97dd400244bc -- You are receiving this mail because: You are watching all bug changes.
[kdenlive] [Bug 445676] New: Shutdown computer after renderings option grayed out on Ubuntu with LXDE
https://bugs.kde.org/show_bug.cgi?id=445676 Bug ID: 445676 Summary: Shutdown computer after renderings option grayed out on Ubuntu with LXDE Product: kdenlive Version: 21.04.3 Platform: Ubuntu Packages OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: User Interface Assignee: j...@kdenlive.org Reporter: dan...@danielrosehill.co.il Target Milestone: --- SUMMARY *** Installed Kdenlive via the official PPA. Running on top of Ubuntu 20.10 with LXDE as the desktop environment. In Render, the "Shutdown computer after renderings" checkbox button is grayed out and cannot be enabled. *** STEPS TO REPRODUCE 1. Install LXDE on top of Ubuntu. Boot into LXDE as the DE from the session manager. 2. Access Kdenlive 3. Click the 'Render' button OBSERVED RESULT The 'Shutdown computer after renderings' button is grayed out. EXPECTED RESULT The user should have the ability to toggle on/off a switch entitled 'Shutdown computer after renderings' which will automatically power off the computer when the render queue is concluded. SOFTWARE/OS VERSIONS Linux/KDE Plasma: 20.10. (available in About System) KDE Plasma Version: N/A KDE Frameworks Version: N/A Qt Version: N/A. Running LXDE. ADDITIONAL INFORMATION -- You are receiving this mail because: You are watching all bug changes.
[okular] [Bug 305534] Annotations don't show all non-ASCII letters
https://bugs.kde.org/show_bug.cgi?id=305534 Yuri Chornoivan changed: What|Removed |Added CC||azazabc...@gmail.com --- Comment #70 from Yuri Chornoivan --- *** Bug 445674 has been marked as a duplicate of this bug. *** -- You are receiving this mail because: You are watching all bug changes.
[okular] [Bug 445674] Okular: Typewriter cannot rendered non-Latin characters. (but the annotation created by other PDF reader can be rendered by Okular...)
https://bugs.kde.org/show_bug.cgi?id=445674 Yuri Chornoivan changed: What|Removed |Added CC||yurc...@ukr.net Status|REPORTED|RESOLVED Resolution|--- |DUPLICATE --- Comment #1 from Yuri Chornoivan --- *** This bug has been marked as a duplicate of bug 305534 *** -- You are receiving this mail because: You are watching all bug changes.
[lattedock] [Bug 444588] GLobal menu don't go away on closing KDE Systemsettings
https://bugs.kde.org/show_bug.cgi?id=444588 vdovgan...@gmail.com changed: What|Removed |Added Status|NEEDSINFO |REPORTED Resolution|WAITINGFORINFO |--- -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445657] Loading 250 Frames performance problem and jump back/forward buttons doesn't seem to do ANYTHING
https://bugs.kde.org/show_bug.cgi?id=445657 --- Comment #4 from Hoang Duy Tran --- I was using nightly build (krita-nightly_d2f29d7.dmg), downloaded on 14/11/2021. After read your comment, I went to download the 'krita-5.0.0-beta2.dmg' (today, 18/11/2021) and was able loading all 250 frames, with little delay (sustainable), I still notice the delay when I started playing 'Cache regeneration..' but no 99% stuck as previous version. Still the 'Skip Back' button moves 1 frame backward, identical to the 'Back' button, and 'Skip Forward' button is functioning exactly like the 'Forward' button. I don't understand why you'd need TWO BUTTONS performing exactly the same function. If I was editing I would JUMP by my mouse to a position where I would like to place my next frame, this must be done by MOUSE POINTER, only when I would like to jump to the beginning should I use 'Skip Back' (or rather misleading name, it looks more like 'First Frame' button) and the other looks more like 'Last Frame' button, honestly. -- You are receiving this mail because: You are watching all bug changes.
[frameworks-kirigami] [Bug 445277] f8e14f9c Breaks KeyEvent emitting
https://bugs.kde.org/show_bug.cgi?id=445277 --- Comment #7 from Oleg Solovyov --- Clean BTs w/o optimization in Qt and static functions broken: #0 QQuickWindow::QQuickWindow (this=0x5686cc30, dd=..., control=0x5709d3f0) at items/qquickwindow.cpp:1504 #1 0x7fff94feeb54 in QQuickWidgetPrivate::init (this=0x572083a0, e=0x0) at qquickwidget.cpp:108 #2 0x7fff95018d26 in Dialog::Private::createTab (file=..., title=..., this=0x7fffec00eee0) at /usr/src/debug/plasma-desktop-5.23.3/kcms/activities/imports/dialog.cpp:66 #3 Dialog::Dialog (this=0x5652b480, parent=0x0) at /usr/src/debug/plasma-desktop-5.23.3/kcms/activities/imports/dialog.cpp:132 #4 0x7fff9501a5df in ActivitySettings::configureActivity (this=, id=...) at /usr/src/debug/plasma-desktop-5.23.3/kcms/activities/imports/activitysettings.cpp:37 fine: #0 QWidgetWindow::QWidgetWindow (this=0x579b7a80, widget=0x57853dd0) at kernel/qwidgetwindow.cpp:159 #1 0x768a1ea0 in QWidgetPrivate::createTLSysExtra (this=0x5783bc40) at kernel/qwidget.cpp:1369 #2 0x768a15f5 in QWidgetPrivate::create (this=0x5783bc40) at kernel/qwidget.cpp:1252 #3 0x768a1100 in QWidget::create (this=0x57853dd0, window=0, initializeWindow=true, destroyOldWindow=true) at kernel/qwidget.cpp:1179 #4 0x768b659b in QWidgetPrivate::setVisible (this=0x5783bc40, visible=true) at kernel/qwidget.cpp:8063 #5 0x768b6452 in QWidget::setVisible (this=0x57853dd0, visible=true) at kernel/qwidget.cpp:8044 #6 0x76b179d6 in QDialog::setVisible (this=0x57853dd0, visible=true) at dialogs/qdialog.cpp:787 #7 0x768b5247 in QWidget::show (this=0x57853dd0) at kernel/qwidget.cpp:7670 #8 0x7fff950c65f2 in ActivitySettings::configureActivity (this=, id=...) at /usr/src/debug/plasma-desktop-5.23.3/kcms/activities/imports/activitysettings.cpp:39 -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445667] Cannot load video wall config
https://bugs.kde.org/show_bug.cgi?id=445667 Bug Janitor Service changed: What|Removed |Added Status|CONFIRMED |ASSIGNED --- Comment #2 from Bug Janitor Service --- A possibly relevant merge request was started @ https://invent.kde.org/plasma/kwin/-/merge_requests/1682 -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445667] Cannot load video wall config
https://bugs.kde.org/show_bug.cgi?id=445667 Alexander Lohnau changed: What|Removed |Added Assignee|kwin-bugs-n...@kde.org |alexander.loh...@gmx.de Ever confirmed|0 |1 Status|REPORTED|CONFIRMED --- Comment #1 from Alexander Lohnau --- The issue is that in the KPluginSelector the arguments do not get correctly set. In fact, one can not et the args on a per-plugin base. I will work on a fix, it should be possible by reading the metadata inside of the factory as a fallback. -- You are receiving this mail because: You are watching all bug changes.
[Discover] [Bug 422432] When opening KDE - Discover Homepage displays error message: "Unable to load applications. Please verify internet connectivity."
https://bugs.kde.org/show_bug.cgi?id=422432 --- Comment #27 from Misha --- May be it help. Look at the conflict between appstream-data and appstream-data-pamac. -- You are receiving this mail because: You are watching all bug changes.
[kdenlive] [Bug 445675] New: Rendering widescreen 16:9 format to DVD always adds black bars
https://bugs.kde.org/show_bug.cgi?id=445675 Bug ID: 445675 Summary: Rendering widescreen 16:9 format to DVD always adds black bars Product: kdenlive Version: 21.08.3 Platform: Other OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: Video Display & Export Assignee: j...@kdenlive.org Reporter: norb...@preining.info Target Milestone: --- SUMMARY It is not possible to render to widescreen DVD (NTSC) without adding black bars at top bottom, despite input data is 16:9. All renderings to DVD (VOB) result in 4:3 rendered video with black bars, which, when shown on a normal modern TV, results in wrong aspect ratio. STEPS TO REPRODUCE 1. create a project in some 16:9 format 2. render to SD/DVD OBSERVED RESULT output contains black bars at top bottom EXPECTED RESULT correctly encoded video that shows full screen (filling the full screen) of a 16:9 TV SOFTWARE/OS VERSIONS Operating System: Debian GNU/Linux KDE Plasma Version: 5.23.3 KDE Frameworks Version: 5.88.0 Qt Version: 5.15.2 ADDITIONAL INFORMATION Changing the Project format to NTSC widescreen does not help, rendering to DVD again creates black bars. Changing the project to DVD, black bars are already added in the preview. What I currently do is: * render to 16:9 mp4 high quality * use videotrans' movie-to-dvd with the respective options -m ntsc -q high -a 16:9 -M * use dvdauthor to create the dvd structure using the previously created vob file * burn -- You are receiving this mail because: You are watching all bug changes.
[okular] [Bug 445674] Okular: Typewriter cannot rendered non-Latin characters. (but the annotation created by other PDF reader can be rendered by Okular...)
https://bugs.kde.org/show_bug.cgi?id=445674 ono changed: What|Removed |Added CC||azazabc...@gmail.com -- You are receiving this mail because: You are watching all bug changes.
[frameworks-syntax-highlighting] [Bug 445649] OrgMode syntax highlighting support
https://bugs.kde.org/show_bug.cgi?id=445649 --- Comment #2 from Gary Wang --- (In reply to Waqar Ahmed from comment #1) > If you have created a syntax file for org mode, feel free to make a merge > request with it. It doesn't have to be perfect, you can improve it with time. Thanks! My current syntax file is here. It still lacks some functionality, I still cannot figure out how to make it foldable by heading level but anyway it's here. Any help is appreciated. https://invent.kde.org/frameworks/syntax-highlighting/-/merge_requests/272 -- You are receiving this mail because: You are watching all bug changes.
[okular] [Bug 445674] New: Okular: Typewriter cannot rendered non-Latin characters. (but the annotation created by other PDF reader can be rendered by Okular...)
https://bugs.kde.org/show_bug.cgi?id=445674 Bug ID: 445674 Summary: Okular: Typewriter cannot rendered non-Latin characters. (but the annotation created by other PDF reader can be rendered by Okular...) Product: okular Version: unspecified Platform: Manjaro OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: PDF backend Assignee: okular-de...@kde.org Reporter: azazabc...@gmail.com Target Milestone: --- Created attachment 143682 --> https://bugs.kde.org/attachment.cgi?id=143682=edit This single PDF file contains both annotations created/edited by Okular and Xodo. They are rendered incorrectly in Okular, but can be rendered in Xodo correctly. SUMMARY *** NOTE: If you are reporting a crash, please try to attach a backtrace with debug symbols. See https://community.kde.org/Guidelines_and_HOWTOs/Debugging/How_to_create_useful_crash_reports *** (1.) In Typewriter input box, non-Latin characters can be entered though, but will not be rendered in document. Cyrillic alphabets and Japanese Kanji & Hiragana are all disappeared: https://invent.kde.org/graphics/okular/uploads/71e69e3298defce8cd9d2163a11c1104/Screenshot_2028_113122.png (2.) Even though set font with `Noto Sans CJK JP` (Which should include Latin, Cyrillic, Greek, Japanese Kanji+Hiragana+Katakana), the characters still cannot be showed: https://invent.kde.org/graphics/okular/uploads/bce8badba4985a8b6f03edce50843722/Screenshot_2028_113837.png (3.) The more interesting is, open the annotated file with another PDF reader (Xodo for Android), the annotation created by Okular can be read & rendered correctly: https://invent.kde.org/graphics/okular/uploads/18c71a48ac48b81038c5dd1a80caaa2a/Screenshot_2028-114739335.jpg (4.) The most interesting is, if: (a) Create text annotation with some other proprietary PDF reader (for example, Xodo PDF Reader). **OR** (b) Process the Okular-annotated *.pdf file with `pdftk` (for example: `pdftk okular-annotated.pdf cat 1 output pdftk-processed-okular-annotated.pdf`) The non-Latin text annotations are visible in Okular. STEPS TO REPRODUCE (In Okular) 1. Alt+5 to use Typewriter to create a text annotation. 2. Enter Latin & non-Latin characters into Typewriter. 3. The non-Latin characters will become invisible. 4. Save file. (In Xodo PDF Reader) 5. Open the Okular-saved-file with Xodo PDF Reader, (a) Create any text annotation, **OR** (b) Edit the existed Typewriter annotations created by Okular 6. Save file. (In Okular) 7. Open the Xodo-saved-file with Okular, the non-Latin annotations are rendered CORRECTLY. 8. HOWEVER, if modifying these correct annotations via Okular, the non-Latin characters will become invisible again... OBSERVED RESULT I tested with Xodo and `pdftk`, as long as the PDF files containing Okular-created annotations are saved by them, all non-Latin characters are all rendered correctly. EXPECTED RESULTS Okular can **create or edit** Typewriter annotation & display all non-Latin characters. SOFTWARE/OS VERSIONS - Okular version: `21.08.2` - Linux/KDE Plasma: Manjaro (rolling upgrade distro), - KDE Plasma Version: `5.22.5` - KDE Frameworks Version: `5.87.0` - Qt Version: `5.15.2` ADDITIONAL INFORMATION -- You are receiving this mail because: You are watching all bug changes.
[ark] [Bug 445610] Cannot create new archives
https://bugs.kde.org/show_bug.cgi?id=445610 Nate Graham changed: What|Removed |Added Priority|NOR |VHI CC||n...@kde.org Keywords||regression -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445673] New: FPS drops to 1 after compositor power off or restart
https://bugs.kde.org/show_bug.cgi?id=445673 Bug ID: 445673 Summary: FPS drops to 1 after compositor power off or restart Product: kwin Version: unspecified Platform: Kubuntu Packages OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: compositing Assignee: kwin-bugs-n...@kde.org Reporter: luis48...@hotmail.com Target Milestone: --- Created attachment 143681 --> https://bugs.kde.org/attachment.cgi?id=143681=edit Video showcasing the bug SUMMARY Not sure whether this is a KWin problem or not Whenever the compositor restarts, changes configuration or is turned off the desktop framerate drops to 1 I confirmed this with the Show FPS window effect, the FPS goes back to normal when I log out of the system This did not happen with Kubuntu LTS A video demostrating what happens is attached to this report STEPS TO REPRODUCE 1. Go into Settings > Display > Compositor 2. Change anything 3. Apply OBSERVED RESULT FPS Drops to 1 EXPECTED RESULT Should just change the settings SOFTWARE/OS VERSIONS Operating System: Kubuntu 21.04 KDE Plasma Version: 5.21.4 KDE Frameworks Version: 5.80.0 Qt Version: 5.15.2 Kernel Version: 5.11.0-40-generic OS Type: 64-bit Graphics Platform: X11 Processors: 4 × Intel® Core™ i3-6100 CPU @ 3.70GHz Memory: 7,2 GiB of RAM Graphics Processor: Mesa Intel® HD Graphics 530 -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445672] Color banding on openGL canvas view when output format is set to Rec.2020(10 bit)
https://bugs.kde.org/show_bug.cgi?id=445672 --- Comment #2 from 2376112...@qq.com --- Created attachment 143680 --> https://bugs.kde.org/attachment.cgi?id=143680=edit The gradient png file used in the screenshot, which is the gradient supposed to look like -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445672] Color banding on openGL canvas view when output format is set to Rec.2020(10 bit)
https://bugs.kde.org/show_bug.cgi?id=445672 --- Comment #1 from 2376112...@qq.com --- Created attachment 143679 --> https://bugs.kde.org/attachment.cgi?id=143679=edit Screenshot: color banding at canvas -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445672] New: Color banding on openGL canvas view when output format is set to Rec.2020(10 bit)
https://bugs.kde.org/show_bug.cgi?id=445672 Bug ID: 445672 Summary: Color banding on openGL canvas view when output format is set to Rec.2020(10 bit) Product: krita Version: 4.4.8 Platform: Microsoft Windows OS: Microsoft Windows Status: REPORTED Severity: normal Priority: NOR Component: OpenGL Canvas Assignee: krita-bugs-n...@kde.org Reporter: 2376112...@qq.com Target Milestone: --- SUMMARY Color gradient at canvas becomes color banding and stair-stepping-like when output format is set to Rec. 2020 PQ (10 bit) and Canvas Graphic Acceleration is enabled. When the color gradient is export to png file and viewed at other software, it retains smooth which it is supposed to be. Turning off Canvas Graphic Acceleration when Rec. 2020 PQ (10 bit) is on would make color gradient smooth, but it is slow and raises some rendering flaws. STEPS TO REPRODUCE 1. At Display-HDR settings-Preferred Output Format, chose Rec. 2020 PQ (10 bit). 2. Reboot Krita. 3. Create a new file. (color depth and icc profile keep default) 4. Paint some color gradient on canvas. OBSERVED RESULT Color banding and stair-stepping EXPECTED RESULT Color gradient should be smooth. SOFTWARE/OS VERSIONS Windows 10 ADDITIONAL INFORMATION GPU: It can be reproduced on my nvidia 1650, 3050 laptop and amd integated GPU on 5800U, with latest driver. Screen: It can be reproduced on my HDR400 capable screen and normal 8bit laptop screen. I have tried changing file color depth and icc profile, but banding still reproduced. -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445581] Krita crashes when selecting a brush
https://bugs.kde.org/show_bug.cgi?id=445581 Bug Janitor Service changed: What|Removed |Added Resolution|REMIND |--- Status|NEEDSINFO |REPORTED --- Comment #3 from Bug Janitor Service --- Thanks for your comment! Automatically switching the status of this bug to REPORTED so that the KDE team knows that the bug is ready to get confirmed. In the future you may also do this yourself when providing needed information. -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 444618] Editing system monitor applets looks causes desktop to crash and restart
https://bugs.kde.org/show_bug.cgi?id=444618 --- Comment #4 from Bug Janitor Service --- Dear Bug Submitter, This bug has been in NEEDSINFO status with no change for at least 15 days. Please provide the requested information as soon as possible and set the bug status as REPORTED. Due to regular bug tracker maintenance, if the bug is still in NEEDSINFO status with no change in 30 days the bug will be closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging If you have already provided the requested information, please mark the bug as REPORTED so that the KDE team knows that the bug is ready to be confirmed. Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[lattedock] [Bug 438127] latte crashes occasionally at login of dual-monitor setup
https://bugs.kde.org/show_bug.cgi?id=438127 --- Comment #10 from Bug Janitor Service --- Dear Bug Submitter, This bug has been in NEEDSINFO status with no change for at least 15 days. Please provide the requested information as soon as possible and set the bug status as REPORTED. Due to regular bug tracker maintenance, if the bug is still in NEEDSINFO status with no change in 30 days the bug will be closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging If you have already provided the requested information, please mark the bug as REPORTED so that the KDE team knows that the bug is ready to be confirmed. Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[kde] [Bug 443969] KDE crashes on login when using Nvidia blob drivers
https://bugs.kde.org/show_bug.cgi?id=443969 Bug Janitor Service changed: What|Removed |Added Status|NEEDSINFO |RESOLVED Resolution|WAITINGFORINFO |WORKSFORME --- Comment #5 from Bug Janitor Service --- This bug has been in NEEDSINFO status with no change for at least 30 days. The bug is now closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[Spectacle] [Bug 443060] Feature request: sequential screenshots (configurable)
https://bugs.kde.org/show_bug.cgi?id=443060 --- Comment #9 from Bug Janitor Service --- Dear Bug Submitter, This bug has been in NEEDSINFO status with no change for at least 15 days. Please provide the requested information as soon as possible and set the bug status as REPORTED. Due to regular bug tracker maintenance, if the bug is still in NEEDSINFO status with no change in 30 days the bug will be closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging If you have already provided the requested information, please mark the bug as REPORTED so that the KDE team knows that the bug is ready to be confirmed. Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[kdenlive] [Bug 443507] Kdenlive crashed when duplicating multiple clips
https://bugs.kde.org/show_bug.cgi?id=443507 --- Comment #2 from Bug Janitor Service --- Dear Bug Submitter, This bug has been in NEEDSINFO status with no change for at least 15 days. Please provide the requested information as soon as possible and set the bug status as REPORTED. Due to regular bug tracker maintenance, if the bug is still in NEEDSINFO status with no change in 30 days the bug will be closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging If you have already provided the requested information, please mark the bug as REPORTED so that the KDE team knows that the bug is ready to be confirmed. Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[kmymoney] [Bug 432582] imports accounts to incorrect account
https://bugs.kde.org/show_bug.cgi?id=432582 --- Comment #3 from Bug Janitor Service --- Dear Bug Submitter, This bug has been in NEEDSINFO status with no change for at least 15 days. Please provide the requested information as soon as possible and set the bug status as REPORTED. Due to regular bug tracker maintenance, if the bug is still in NEEDSINFO status with no change in 30 days the bug will be closed as RESOLVED > WORKSFORME due to lack of needed information. For more information about our bug triaging procedures please read the wiki located here: https://community.kde.org/Guidelines_and_HOWTOs/Bug_triaging If you have already provided the requested information, please mark the bug as REPORTED so that the KDE team knows that the bug is ready to be confirmed. Thank you for helping us make KDE software even better for everyone! -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445671] New: Pressing the "overview" hotkey twice doesn't end the effect, if the hotkey is non-default.
https://bugs.kde.org/show_bug.cgi?id=445671 Bug ID: 445671 Summary: Pressing the "overview" hotkey twice doesn't end the effect, if the hotkey is non-default. Product: kwin Version: 5.23.3 Platform: Archlinux Packages OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: effects-overview Assignee: kwin-bugs-n...@kde.org Reporter: ad.liu@gmail.com Target Milestone: --- SUMMARY In the "overview" effect, Pressing the default hotkey (Ctrl-Meta-D) again ends the effect. (The same behavior as in "present windows" and "desktop grid") However, if I change the hotkey to Meta-Q, pressing it again in the effect doesn't end the effect. Instead a "q" is entered in the search box. STEPS TO REPRODUCE 1. Enable "overview" effect. 2. Change the hotkey to Meta-Q. 3. Press Meta-Q to enter overview. 4. Press Meta-Q again. OBSERVED RESULT A "q" appears in the search box. EXPECTED RESULT The effect ends. SOFTWARE/OS VERSIONS Windows: macOS: Linux/KDE Plasma: (available in About System) KDE Plasma Version: 5.23.3 KDE Frameworks Version: 5.88.0 Qt Version: 5.15.2 ADDITIONAL INFORMATION -- You are receiving this mail because: You are watching all bug changes.
[kgeography] [Bug 445670] New: Mississippi state flag has been updated
https://bugs.kde.org/show_bug.cgi?id=445670 Bug ID: 445670 Summary: Mississippi state flag has been updated Product: kgeography Version: unspecified Platform: Archlinux Packages OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: general Assignee: aa...@kde.org Reporter: thatsjustwy...@icloud.com CC: lauran...@free.fr Target Milestone: --- SUMMARY Mississippi's state flag has changed, to this: https://commons.wikimedia.org/wiki/File:Flag_of_Mississippi.svg and kgeography is still using the old flag STEPS TO REPRODUCE 1. Open kgeography 2. Click on Mississippi OBSERVED RESULT Old flag in popup EXPECTED RESULT New flag in popup SOFTWARE/OS VERSIONS Linux/KDE Plasma: 5.14.16-arch1-1 (64bit) (available in About System) KDE Plasma Version: 5.23.3 KDE Frameworks Version: 5.87.0 Qt Version: 5.15.2 ADDITIONAL INFORMATION kgeography Version: 21.08.03 -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 413034] Cursor flickers/artifacts with fractional scaling on wayland
https://bugs.kde.org/show_bug.cgi?id=413034 Nate Graham changed: What|Removed |Added CC||poperi...@mailbox.org --- Comment #5 from Nate Graham --- *** Bug 445448 has been marked as a duplicate of this bug. *** -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 Nate Graham changed: What|Removed |Added Resolution|WAITINGFORINFO |DUPLICATE Status|NEEDSINFO |RESOLVED --- Comment #6 from Nate Graham --- Gotcha, thanks. Looks like this is Bug 413034. *** This bug has been marked as a duplicate of bug 413034 *** -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 --- Comment #5 from poperi...@mailbox.org --- (In reply to Nate Graham from comment #4) > Hmm, Zoom is a Qt app. Not any KDE apps? My bad, it actually does happen on everything. It's just hard to tell on a dark background, and I'm using a dark theme. -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 --- Comment #4 from Nate Graham --- Hmm, Zoom is a Qt app. Not any KDE apps? -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 poperi...@mailbox.org changed: What|Removed |Added Flags|Wayland+| -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 --- Comment #3 from poperi...@mailbox.org --- (In reply to Nate Graham from comment #2) > Works for me with 200% scaling. > > Does it only happen over Firefox, or with other apps too? It also happens with Zoom and Thunderbird. Probably something to do with web engines? -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 442544] Krita 5.0's Shift modifier to change brush size is not behaving as expected.
https://bugs.kde.org/show_bug.cgi?id=442544 --- Comment #11 from Emmet O'Neill --- Oh, and one other thing that I just thought of... In regards to the NW - SE "fault-line" issue that I mentioned above: if you are left handed like me, then a big part of the problem could be that this fault-line coincides with one of the more naturally comfortable brush stroke directions. Random thought, but that's certainly something to consider... -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 442544] Krita 5.0's Shift modifier to change brush size is not behaving as expected.
https://bugs.kde.org/show_bug.cgi?id=442544 Emmet O'Neill changed: What|Removed |Added Resolution|NOT A BUG |FIXED --- Comment #10 from Emmet O'Neill --- (In reply to Tyson Tan from comment #9) > Thank you Emmet! :) You're welcome Tyson. If this is hurting your ability to illustrate with Krita, then it's certainly safer and smarter to revert it for now. However, I want to note a few things: 1. The ability to resize the brush by dragging vertically (as an alternative to the existing horizontal drag) was something that had been user requested. This request seems pretty reasonable, as there's nothing that makes horizontal dragging for brush size any more intuitive or ergonomic than vertical. While reverting this patch is positive from your perspective (and that certainly means a lot considering your long relationship the project), it's important to keep in mind that it will be disappointing to those who requested it. This can be remedied by making this behavior configurable, but even then people will disagree over what the default behavior should be. It's also not something we can do right now, since we're in string freeze for Krita 5.0. 2. From my personal testing and painting recently, I'd argue that the problem is being overstated here. The awkward fighting/jumping between enlarging and reducing brush sizes only occurs in two very specific directions, 4:30 and 10:30 o'clock, for lack of a better description. Of course, this is the natural fulcrum/fault-line where we draw a distinction between enlargement (right/up) and reduction (left/down). You'll notice that this issue has always existed with Krita, and continues to exist after this patch has been reverted, it's just that we've shifted the problem angles. If you hold shift and drag directly up or down even after the revert, you'll experience the same annoying clash between brush enlargement and reduction that this bug is describing, and (when you factor out muscle memory) I'd argue that it's in an even more annoying place. There's the possibility of creating a dead zone or buffer between the enlargement direction and reduction direction, but that would of course mean that nothing at all would happen when dragging perfectly along the fault-line. I'm not sure if that's any better than the clashing situation, but maybe it's worth trying... 3. I think we can agree that intuitive pen gestures like this are an important part of painting workflow. I'd like us to have an open mind in the future and explore other possibilities for improving quick gesture-based controls, because it could lead to a more expressive and fluent interaction for artists. Since shift brush size change was the key function that brought you to Krita, then I think it's safe to say that there is a lot of potential value in making this feature better or developing related features--it's just a matter of figuring out ways that we can do it that are net-positive and flexible enough to suit the tastes of various artists, and your input will be a huge help in getting there. --- Anyway, I'm playing it safe here and reverting because your experience and opinions are important to us! I hope you'll consider the points I'm making and let us know what you think can be done to improve and build upon these kinds of gestures. Thanks as always for the report Tyson, Emmet -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445507] kwin_wayland crashes on simpledrm
https://bugs.kde.org/show_bug.cgi?id=445507 --- Comment #8 from bluescreenaven...@gmail.com --- Rebuilding Master The commit gets me further, but I still get the above new stack trace -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445499] Cursor is one size bigger than it is on X11, when hovering over something built with Qt
https://bugs.kde.org/show_bug.cgi?id=445499 Nate Graham changed: What|Removed |Added Resolution|--- |WAITINGFORINFO Target Milestone|1.0 |--- Component|general |wayland-generic Assignee|k...@davidedmundson.co.uk|kwin-bugs-n...@kde.org CC||n...@kde.org Status|REPORTED|NEEDSINFO Product|plasmashell |kwin --- Comment #1 from Nate Graham --- What you're reporting is actually not a bug, but the intended state of affairs.:) If you use a 24px cursor and 150% scaling, 36 is 150% bigger than 24, so that's expected. You just got used to this not happening on X11, which was always a bug. However there is a bug here: thr fact that this *doesn't* happen for all apps. You said it happens with Qt apps, but it's not working for which other apps? GTK? Electron? Custom UI toolkit like Blender? Every other apps besides anything built with Qt? -- You are receiving this mail because: You are watching all bug changes.
[dolphin] [Bug 444712] dolphin sometime opens off monitor
https://bugs.kde.org/show_bug.cgi?id=444712 --- Comment #3 from Rajinder Yadav --- Hello the issue has occurred again, running dolphin from the terminal shows the following output $ dolphin Qt: Session management error: networkIdsList argument is NULL -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445669] New: plasma crashes when closing Minecraft
https://bugs.kde.org/show_bug.cgi?id=445669 Bug ID: 445669 Summary: plasma crashes when closing Minecraft Product: plasmashell Version: 5.22.5 Platform: Ubuntu Packages OS: Linux Status: REPORTED Keywords: drkonqi Severity: crash Priority: NOR Component: general Assignee: k...@davidedmundson.co.uk Reporter: bearcub...@protonmail.com CC: plasma-b...@kde.org Target Milestone: 1.0 Application: plasmashell (5.22.5) Qt Version: 5.15.2 Frameworks Version: 5.86.0 Operating System: Linux 5.13.0-21-generic x86_64 Windowing System: Wayland Drkonqi Version: 5.22.5 Distribution: Ubuntu 21.10 -- Information about the crash: Plasma crashes whenever I close Minecraft either by clicking on either the x in the corner or the quit game button. The crash can be reproduced sometimes. -- Backtrace: Application: Plasma (plasmashell), signal: Aborted [KCrash Handler] #4 __pthread_kill_implementation (no_tid=0, signo=6, threadid=139729384630656) at pthread_kill.c:44 #5 __pthread_kill_internal (signo=6, threadid=139729384630656) at pthread_kill.c:80 #6 __GI___pthread_kill (threadid=139729384630656, signo=signo@entry=6) at pthread_kill.c:91 #7 0x7f154c5f5476 in __GI_raise (sig=sig@entry=6) at ../sysdeps/posix/raise.c:26 #8 0x7f154c5db7b7 in __GI_abort () at abort.c:79 #9 0x7f154ca82ba3 in QMessageLogger::fatal(char const*, ...) const () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #10 0x7f154aca8e45 in ?? () from /lib/x86_64-linux-gnu/libQt5WaylandClient.so.5 #11 0x7f154acb906a in QtWaylandClient::QWaylandDisplay::flushRequests() () from /lib/x86_64-linux-gnu/libQt5WaylandClient.so.5 #12 0x7f154cce2a88 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #13 0x7f154cce5f63 in QSocketNotifier::activated(QSocketDescriptor, QSocketNotifier::Type, QSocketNotifier::QPrivateSignal) () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #14 0x7f154cce6793 in QSocketNotifier::event(QEvent*) () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #15 0x7f154d9936b3 in QApplicationPrivate::notify_helper(QObject*, QEvent*) () from /lib/x86_64-linux-gnu/libQt5Widgets.so.5 #16 0x7f154ccab16a in QCoreApplication::notifyInternal2(QObject*, QEvent*) () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #17 0x7f154cd05155 in ?? () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #18 0x7f154b0e68bb in g_main_context_dispatch () from /lib/x86_64-linux-gnu/libglib-2.0.so.0 #19 0x7f154b139f08 in ?? () from /lib/x86_64-linux-gnu/libglib-2.0.so.0 #20 0x7f154b0e4003 in g_main_context_iteration () from /lib/x86_64-linux-gnu/libglib-2.0.so.0 #21 0x7f154cd04548 in QEventDispatcherGlib::processEvents(QFlags) () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #22 0x7f154cca9a9b in QEventLoop::exec(QFlags) () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #23 0x7f154ccb2024 in QCoreApplication::exec() () from /lib/x86_64-linux-gnu/libQt5Core.so.5 #24 0x55709c06ee0c in ?? () #25 0x7f154c5dcfd0 in __libc_start_call_main (main=main@entry=0x55709c06dec0, argc=argc@entry=1, argv=argv@entry=0x7ffd5c330dd8) at ../sysdeps/nptl/libc_start_call_main.h:58 #26 0x7f154c5dd07d in __libc_start_main_impl (main=0x55709c06dec0, argc=1, argv=0x7ffd5c330dd8, init=, fini=, rtld_fini=, stack_end=0x7ffd5c330dc8) at ../csu/libc-start.c:409 #27 0x55709c06ef35 in ?? () [Inferior 1 (process 1359) detached] Possible duplicates by query: bug 445496, bug 445479, bug 445409, bug 445355, bug 444014. Reported using DrKonqi -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 Nate Graham changed: What|Removed |Added Status|REPORTED|NEEDSINFO Component|compositing |wayland-generic CC||n...@kde.org Resolution|--- |WAITINGFORINFO --- Comment #2 from Nate Graham --- Works for me with 200% scaling. Does it only happen over Firefox, or with other apps too? -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445257] Layer visibility status can be different between the layer panel and timeline
https://bugs.kde.org/show_bug.cgi?id=445257 Eoin O'Neill changed: What|Removed |Added Summary|Layer visibility status can |Layer visibility status can |be different from the layer |be different between the |panel and timeline |layer panel and timeline -- You are receiving this mail because: You are watching all bug changes.
[frameworks-plasma] [Bug 445516] Cache-related visual glitches when Plasma theme SVGs or Plasma Components are updated
https://bugs.kde.org/show_bug.cgi?id=445516 --- Comment #4 from Nate Graham --- This appears to be a widespread issue following the style update in Frameworks 5.88. See for example https://www.reddit.com/r/kde/comments/qwbnmv/various_ui_bugs_since_plasma_5233/. -- You are receiving this mail because: You are watching all bug changes.
[dolphin] [Bug 435049] [wayland] - the option "open new folders in tabs" does not work
https://bugs.kde.org/show_bug.cgi?id=435049 David Edmundson changed: What|Removed |Added Version Fixed In||21.12 Status|CONFIRMED |RESOLVED Resolution|--- |FIXED CC||k...@davidedmundson.co.uk --- Comment #6 from David Edmundson --- This is now resolved in 5e84fffd6ed97a173d7250e7563998ea5dc395a0 -- You are receiving this mail because: You are watching all bug changes.
[krunner] [Bug 436223] Krunner incorrectly sets "GDK_SCALE" and "GDK_DPI_SCALE" under wayland and HiDPI
https://bugs.kde.org/show_bug.cgi?id=436223 David Edmundson changed: What|Removed |Added CC||k...@davidedmundson.co.uk Status|REPORTED|RESOLVED Resolution|--- |FIXED --- Comment #4 from David Edmundson --- We now reset this var explicitly, please reopen it's an issue on Plasma 5.23 or newer -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 403281] Spare layouts doesn't work
https://bugs.kde.org/show_bug.cgi?id=403281 David Edmundson changed: What|Removed |Added Resolution|--- |FIXED Status|CONFIRMED |RESOLVED --- Comment #9 from David Edmundson --- this was implemented a while ago -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 440575] Suggest changing the Virtual Keyboard applet to show and hide the virtual keyboard, rather than enabling and disabling it
https://bugs.kde.org/show_bug.cgi?id=440575 David Edmundson changed: What|Removed |Added Status|REPORTED|RESOLVED CC||k...@davidedmundson.co.uk Resolution|--- |FIXED --- Comment #1 from David Edmundson --- Whilst not changed quite like suggested, the behavior has changed since this was opened -- You are receiving this mail because: You are watching all bug changes.
[lokalize] [Bug 424024] Main window doesn't repaint correctly on Wayland
https://bugs.kde.org/show_bug.cgi?id=424024 David Edmundson changed: What|Removed |Added Status|REOPENED|NEEDSINFO Resolution|--- |WAITINGFORINFO --- Comment #18 from David Edmundson --- needs a trace to be Probably fixed with my commit above, it was reopened without confirming frameworks version. if it's not please add backtrace as requested. -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445561] Krita 5 16bit integer colorspace canvas rendering is broken on M1
https://bugs.kde.org/show_bug.cgi?id=445561 --- Comment #7 from vanyossi --- This bug is only present in master and krita 5 beta2. The bug is not present on krita 5 beta1 or krita 4.x series -- You are receiving this mail because: You are watching all bug changes.
[systemsettings] [Bug 444520] Baloo content indexing resurrects itself after being killed *and* disabled
https://bugs.kde.org/show_bug.cgi?id=444520 --- Comment #7 from Adam Fontenot --- (In reply to tagwerk19 from comment #6) > I'm happy to check behaviour if you can generate a test PDF/SVG and > upload/attach it Here's the original file that caused the problem: https://ipfs.io/ipfs/QmVqWhPuQkE7reTN5F9TiSeA75z62VNaZUSFZz3FdWTLbC Note that it's likely to cause problems if you download it on a system with Baloo's content indexing enabled. So be cautious. And to be clear, I don't have any direct evidence to suggest that this file was responsible for Baloo's balooning index. > > If the index for a file grows to be larger than the original file, kill the > > extraction process, add the file to a list of failed files, delete the index > > for it, and don't try indexing the content of the file again. > I don't think there's an easy relation between the size of the source and > the size of the index. The index contains "lookups", you type a search term > and a list of hits gets pulled off disc. The design decision was for speed; > you get a refined list of hits in Dolphin as you type more letters into the > search box or view your files in folders based on the tags you've given them. That's a fair point. Let me put it a different way. The laptop in question has a 128 GB SSD. That's not an uncommon size for inexpensive laptops that come with an SSD. A user might reserve 50 GB or so for their home partition, and have let's say 35 GB of files on it. My point is just that it's *understandable* for such a user to be upset about an automatically enabled system component randomly deciding to use 5+ GB of the remaining free space. SSDs mean that storage is now often at a premium again, and many users will not be willing to trade a large percent of free space for slightly faster / better file searches. So while I can't speak to the internal architecture or tradeoffs of Baloo, I can say from a user perspective that an index of files using more than 10% of the total size of those files feels really bad. If there's a good reason that you can't guarantee that the index for a file isn't larger than the file, let me suggest an alternative. Is the algorithm Baloo uses to decide whether to create a content index for a file tunable at all? Perhaps an option to limit the size of the Baloo cache could be provided: either X GB or X% of free space. Given the available space, Baloo could manage its storage to not index files that are less usefully indexed. E.g. if there's one file that is 20 MB but using 2 GB of index space, it's going to be the first to go. At any rate, my reasoning for limiting the size of the index on original files was that it's a pretty good heuristic for filtering out files that don't contain indexable content. For example, biologists frequently use plain text "SAM" files, which contain long strings of meaningful but not indexable text, representing bits of DNA and metadata. E.g. "ATAGCACTCAAGCAATCAAATCAAATAGCCAACTCCTTATCTCAACTCTCC". These files might be under 10 MB, and they might have a .sam, .txt, or no extension at all. Obviously such files should not be indexed, but it's difficult for a user to ensure they're eliminating them all. This goes back to the "just works" principle: insofar as possible, content indexing should quietly make searches better without ever significantly impacting system resources. This implies the need for heuristics to prevent indexing files like this. -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445561] Krita 5 16bit integer colorspace canvas rendering is broken on M1
https://bugs.kde.org/show_bug.cgi?id=445561 --- Comment #6 from vanyossi --- Created attachment 143678 --> https://bugs.kde.org/attachment.cgi?id=143678=edit Corrupted display on 16bit integer arm macs This how it loads on macOS M1, Rosetta and arm64 native. -- You are receiving this mail because: You are watching all bug changes.
[frameworks-baloo] [Bug 380456] Suspected memory leak in baloo_file_extractor
https://bugs.kde.org/show_bug.cgi?id=380456 --- Comment #20 from Adam Fontenot --- (In reply to tagwerk19 from comment #19) > I would still suspect memory use rather than CPU as the underlying reason. It's quite possible that you're right about that. I do know the game is sensitive to available memory, possibly because it runs on the internal Intel graphics chip. > > ... baloo_file_extractor is calling out to an external library > > (poppler), and that library is consuming an endlessly growing amount of > > memory (from 1-3 GB before I've killed it). It's probably safe to say that > > this memory usage is in the form of anonymous mappings which can't be > > reclaimed. Baloo *must* take that into account and kill the extractor > > process if it begins affecting system resources. > That's a *lot* of memory for a "pdf to text" conversion 8-] Yes, especially for a random 20 MB PDF I didn't even remember existed. > You see the baloo_file_extractor RAM usage go up during the extraction and > not come down when it is finished? I have never been able to leave it for long enough to finish extracting from the file. It's possible I'd even get an out of RAM hang before then. The Poppler devs estimate at least 7 GB of RAM would be needed to extract text from this file. I even tested their pdftotext command on a system with plenty of RAM, and even then the issue is that it simply takes too long. I've left it running for over an hour on this one file before, and never seen it complete. Moreover, they insist that it's not a bug on their end. The file, in their view, is pathological and the only reasonable solution is not to try to extract text from it. I think I understand that perspective: it's not every day that you come across a PDF with millions of "words" on a single page. So it's on Baloo to bail out if the process takes too long or consumes too much RAM. Here's the bug report I filed with them if you want to follow that conversation: https://gitlab.freedesktop.org/poppler/poppler/-/issues/1173 > Could you see the culprit file in "System Settings > Search" (recent > releases of baloo show the progress of the indexing there) or when running > "balooctl monitor"? Unfortunately, I don't remember. I do remember using lsof and friends to check that it was the only file Baloo had open. I may not have realized at the time that that feature had been added to the Baloo KCM. -- You are receiving this mail because: You are watching all bug changes.
[valgrind] [Bug 445668] Inline stack frame generation is broken for Rust binaries
https://bugs.kde.org/show_bug.cgi?id=445668 Nick Nethercote changed: What|Removed |Added CC||m...@klomp.org -- You are receiving this mail because: You are watching all bug changes.
[valgrind] [Bug 445668] New: Inline stack frame generation is broken for Rust binaries
https://bugs.kde.org/show_bug.cgi?id=445668
Bug ID: 445668
Summary: Inline stack frame generation is broken for Rust
binaries
Product: valgrind
Version: unspecified
Platform: Other
OS: Linux
Status: REPORTED
Severity: normal
Priority: NOR
Component: general
Assignee: jsew...@acm.org
Reporter: n.netherc...@gmail.com
Target Milestone: ---
Here is some DHAT output I am getting with Rust code:
> └── PP 1.14/14 {
> Total: 118,312 bytes (0.05%, 60.74/Minstr) in 11,864 blocks (1.12%,
> 6.09/Minstr), avg size 9.97 bytes, avg lifetime 60,918.19 instrs (0% of
> program duration)
> Max: 40 bytes in 5 blocks, avg size 8 bytes
> At t-gmax: 0 bytes (0%) in 0 blocks (0%), avg size 0 bytes
> At t-end: 0 bytes (0%) in 0 blocks (0%), avg size 0 bytes
> Reads: 178,976 bytes (0.03%, 91.89/Minstr), 1.51/byte
> Writes:130,464 bytes (0.05%, 66.98/Minstr), 1.1/byte
> Allocated at {
> #1: 0xA2D0172:
> _RNvMs0_NtCs5l0EXMQXRMU_21rustc_data_structures17obligation_forestINtB5_16ObligationForestNtNtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfill26PendingPredicateObligationE22register_obligation_atB1v_.llvm.8517020237817239694
> (alloc.rs:87)
> #2: 0xA2C42B2:
> _RINvMs0_NtCs5l0EXMQXRMU_21rustc_data_structures17obligation_forestINtB6_16ObligationForestNtNtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfill26PendingPredicateObligationE19process_obligationsNtB1s_16FulfillProcessorINtB6_7OutcomeB1q_NtNtCsgI90OQiJWEs_11rustc_infer6traits20FulfillmentErrorCodeEEB1w_
> (mod.rs:459)
> #3: 0xA27EA42:
> _RNvMs_NtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfillNtB4_18FulfillmentContext6select.llvm.5302840341462405287
> (fulfill.rs:140)
> }
> }
Here's what it should look like:
>└── PP 1.14/14 {
> Total: 118,312 bytes (0.05%, 60.81/Minstr) in 11,864 blocks (1.12%,
> 6.1/Minstr), avg size 9.97 bytes, avg lifetime 60,857.47 instrs (0% of
> program duration)
> Max: 40 bytes in 5 blocks, avg size 8 bytes
> At t-gmax: 0 bytes (0%) in 0 blocks (0%), avg size 0 bytes
> At t-end: 0 bytes (0%) in 0 blocks (0%), avg size 0 bytes
> Reads: 178,976 bytes (0.03%, 91.99/Minstr), 1.51/byte
> Writes:130,464 bytes (0.05%, 67.05/Minstr), 1.1/byte
> Allocated at {
> #1: 0xA2CD172: alloc (alloc.rs:87)
> #2: 0xA2CD172: alloc_impl (alloc.rs:169)
> #3: 0xA2CD172: allocate (alloc.rs:229)
> #4: 0xA2CD172: exchange_malloc (alloc.rs:318)
> #5: 0xA2CD172:
> new
> (mod.rs:192)
> #6: 0xA2CD172:
> _RNvMs0_NtCs5l0EXMQXRMU_21rustc_data_structures17obligation_forestINtB5_16ObligationForestNtNtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfill26PendingPredicateObligationE22register_obligation_atB1v_.llvm.8517020237817239694
> (mod.rs:376)
> #7: 0xA2C12B2:
> _RINvMs0_NtCs5l0EXMQXRMU_21rustc_data_structures17obligation_forestINtB6_16ObligationForestNtNtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfill26PendingPredicateObligationE19process_obligationsNtB1s_16FulfillProcessorINtB6_7OutcomeB1q_NtNtCsgI90OQiJWEs_11rustc_infer6traits20FulfillmentErrorCodeEEB1w_
> (mod.rs:459)
> #8: 0xA27BA42:
> _RNvMs_NtNtCsdozMG8X9FIu_21rustc_trait_selection6traits7fulfillNtB4_18FulfillmentContext6select.llvm.5302840341462405287
> (fulfill.rs:140)
> }
> }
I bisected the problem to this commit:
commit 75e3ef0f3b834f75f49333d35b5a040060247b03
Author: Mark Wielaard
Date: Thu Sep 16 22:01:47 2021 +0200
readdwarf3: Skip units without addresses when looking for inlined functions
When a unit doesn't cover any addresses skip it because no actual code
will be inside. Also use skip_DIE instead of read_DIE when not parsing
(skipping) children.
Reverting this commit fixed the problem, though the reversion was a bit messy
because some things have changed since.
Mark, I don't understand much about dwarf3. Any idea what might be wrong? I was
profiling the Rust compiler which is very large and complicated. If necessary,
I could try to create a smaller Rust program that reproduces the error.
--
You are receiving this mail because:
You are watching all bug changes.
[krita] [Bug 445561] Krita 5 16bit integer colorspace canvas rendering is broken on M1
https://bugs.kde.org/show_bug.cgi?id=445561 --- Comment #5 from amyspark --- Now that I recall, https://invent.kde.org/graphics/krita/-/merge_requests/1033 also tinkered with the OpenGL stack on HDR (though on OpenGL ES only). -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] Kickoff is maximized if window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 poperi...@mailbox.org changed: What|Removed |Added Summary|Kickoff is maximized if |Kickoff is maximized if |Window placement is set to |window placement is set to |"Maximized" |"Maximized" -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 --- Comment #3 from poperi...@mailbox.org --- (In reply to Nicolas Fella from comment #2) > sort of duplicate of https://bugs.kde.org/show_bug.cgi?id=428859 Yeah, I saw that one, but I thought this was different enough to make a new bug report. -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445561] Krita 5 16bit integer colorspace canvas rendering is broken on M1
https://bugs.kde.org/show_bug.cgi?id=445561 --- Comment #4 from amyspark --- Created attachment 143677 --> https://bugs.kde.org/attachment.cgi?id=143677=edit Screen cap from latest Krita Stable nightly on Intel macOS I grabbed the latest Krita Stable nightly (hash in the screen cap) and opened the image successfully on my 2015 MBP. It seems a Rosetta 2 or (worse) a possible silicon bug. -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445499] Cursor is one size bigger than it is on X11, when hovering over something built with Qt
https://bugs.kde.org/show_bug.cgi?id=445499 poperi...@mailbox.org changed: What|Removed |Added Summary|[Wayland] Cursor is one |Cursor is one size bigger |size bigger than it is on |than it is on X11, when |X11, when hovering over |hovering over something |something built with Qt |built with Qt Keywords||wayland -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445448] Jagged cursor in Firefox, but MOZ_ENABLED_WAYLAND is enabled
https://bugs.kde.org/show_bug.cgi?id=445448 poperi...@mailbox.org changed: What|Removed |Added Summary|[Wayland] Jagged cursor in |Jagged cursor in Firefox, |Firefox, but|but MOZ_ENABLED_WAYLAND is |MOZ_ENABLED_WAYLAND is |enabled |enabled | Keywords||wayland -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 poperi...@mailbox.org changed: What|Removed |Added Summary|[Wayland] Kickoff is|Kickoff is maximized if |maximized if Window |Window placement is set to |placement is set to |"Maximized" |"Maximized" | -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] [Wayland] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 poperi...@mailbox.org changed: What|Removed |Added Keywords||wayland -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445600] Application Dashboard and other applets (like volume controls in system tray) shows grey box under headings
https://bugs.kde.org/show_bug.cgi?id=445600 indecisiveautoma...@gmail.com changed: What|Removed |Added Status|REPORTED|RESOLVED Resolution|--- |FIXED --- Comment #1 from indecisiveautoma...@gmail.com --- Was a cache issue. The following command fixed it: https://www.reddit.com/r/kde/comments/quuqhc/weird_looking_slider_knobs_in_kde_volume_and/ -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445667] Cannot load video wall config
https://bugs.kde.org/show_bug.cgi?id=445667 Nicolas Fella changed: What|Removed |Added CC||alexander.loh...@gmx.de -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445667] New: Cannot load video wall config
https://bugs.kde.org/show_bug.cgi?id=445667 Bug ID: 445667 Summary: Cannot load video wall config Product: kwin Version: git master Platform: Other OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: general Assignee: kwin-bugs-n...@kde.org Reporter: nicolas.fe...@gmx.de Target Milestone: --- STEPS TO REPRODUCE 1. Open scripts KCM 2. Enable video wall script 3. Click configure on the video wall script OBSERVED RESULT settings open EXPECTED RESULT A message saying that settings could not be found SOFTWARE/OS VERSIONS Everything from master This seems to be a regression from https://invent.kde.org/plasma/kwin/-/commit/58c71de952c76fd479b1e1c0ae6228d8ef2051e3 since m_packageName in https://invent.kde.org/plasma/kwin/-/blob/master/src/scripting/genericscriptedconfig.cpp#L71 is now empty -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445561] Krita 5 16bit integer colorspace canvas rendering is broken on M1
https://bugs.kde.org/show_bug.cgi?id=445561 vanyossi changed: What|Removed |Added Summary|Krita 5 opens this PNG |Krita 5 16bit integer |corrupted |colorspace canvas rendering ||is broken on M1 -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445561] Krita 5 opens this PNG corrupted
https://bugs.kde.org/show_bug.cgi?id=445561 vanyossi changed: What|Removed |Added Status|REPORTED|CONFIRMED Ever confirmed|0 |1 --- Comment #3 from vanyossi --- Ok, the patch did not help as libpng is not the issue. After more testing and getting a kra behave like this I found the problem is that Krita on macos arm (Rosetta or native) 16bit integer colorspace rendering is broken. I remember reading the compiler is messing integer casting, I should check the code and see if this is the issue. Im setting to confirmed. -- You are receiving this mail because: You are watching all bug changes.
[dolphin] [Bug 440663] New Dolphin window or tab opened after compression/extraction when certain default options are disabled, or when the job is canceled, or when the Dolphin window that initiated i
https://bugs.kde.org/show_bug.cgi?id=440663 --- Comment #43 from Christian (Fuchs) --- Since that merge request seems to mainly tackle the tabs: can we, for the current branch, get the original change reverted so at least until a proper fix is found people who don't have a very specific configuration won't get a new dolphin window/tab every time they compress / uncompress something? -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445665] Does not appear the first time it is activated
https://bugs.kde.org/show_bug.cgi?id=445665 Nate Graham changed: What|Removed |Added Component|effects-present-windows |effects-overview -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445666] Activation is slow
https://bugs.kde.org/show_bug.cgi?id=445666 Nate Graham changed: What|Removed |Added Component|effects-present-windows |effects-overview -- You are receiving this mail because: You are watching all bug changes.
[Breeze] [Bug 407048] Online Accounts, Connections and Settings shoudn't share the same icon
https://bugs.kde.org/show_bug.cgi?id=407048 andreas changed: What|Removed |Added Resolution|--- |FIXED Latest Commit||https://invent.kde.org/fram ||eworks/breeze-icons/commit/ ||72ee0c027061737d96ebc49d6ba ||3767ac763935e Status|ASSIGNED|RESOLVED --- Comment #3 from andreas --- Git commit 72ee0c027061737d96ebc49d6ba3767ac763935e by Andreas Kainz. Committed on 17/11/2021 at 23:22. Pushed by andreask into branch 'master'. A +1-0icons/preferences/22/preferences-online-accounts.svg A +1-0icons/preferences/32/preferences-online-accounts.svg https://invent.kde.org/frameworks/breeze-icons/commit/72ee0c027061737d96ebc49d6ba3767ac763935e -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445666] New: Activation is slow
https://bugs.kde.org/show_bug.cgi?id=445666 Bug ID: 445666 Summary: Activation is slow Product: kwin Version: git master Platform: Other OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: effects-present-windows Assignee: kwin-bugs-n...@kde.org Reporter: n...@kde.org Target Milestone: --- This is separate from 445665. Once the effect is activated, there is a perceptible lag before windows actually start moving It's like 100-200 ms most of the time, but the delay gets worse if the CPU is under heavy load. By contrast, Present Windows always activates instantly for me, irrespective of CPU load. -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445587] Response to mouse clicks broken
https://bugs.kde.org/show_bug.cgi?id=445587 --- Comment #11 from tgnff...@gmail.com --- It might have been an even older working version on Neon, more split packages or that you hadn't restarted kwin. In any case, it seems to be fixed by an update to qt5-declarative on my end. -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] [Wayland] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 Nicolas Fella changed: What|Removed |Added CC||nicolas.fe...@gmx.de --- Comment #2 from Nicolas Fella --- sort of duplicate of https://bugs.kde.org/show_bug.cgi?id=428859 -- You are receiving this mail because: You are watching all bug changes.
[Breeze] [Bug 407048] Online Accounts, Connections and Settings shoudn't share the same icon
https://bugs.kde.org/show_bug.cgi?id=407048 Bug Janitor Service changed: What|Removed |Added Status|CONFIRMED |ASSIGNED --- Comment #2 from Bug Janitor Service --- A possibly relevant merge request was started @ https://invent.kde.org/frameworks/breeze-icons/-/merge_requests/173 -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445665] New: Does not appear the first time it is activated
https://bugs.kde.org/show_bug.cgi?id=445665 Bug ID: 445665 Summary: Does not appear the first time it is activated Product: kwin Version: git master Platform: Other OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: effects-present-windows Assignee: kwin-bugs-n...@kde.org Reporter: n...@kde.org Target Milestone: --- The first time the Overview effect is activated after KWin starts or restarts, it will not appear. The second time it is activated, it will appear. This reproduces for me on both X11 and Wayland. -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 441309] No window starts out highlighted
https://bugs.kde.org/show_bug.cgi?id=441309 Nate Graham changed: What|Removed |Added Resolution|--- |INTENTIONAL Status|REPORTED|RESOLVED --- Comment #6 from Nate Graham --- The search field has focus now, so it doesn't make sense for a window also have focus. You can focus one with the down arrow key. -- You are receiving this mail because: You are watching all bug changes.
[krita] [Bug 445657] Loading 250 Frames performance problem and jump back/forward buttons doesn't seem to do ANYTHING
https://bugs.kde.org/show_bug.cgi?id=445657 vanyossi changed: What|Removed |Added CC||ghe...@gmail.com --- Comment #3 from vanyossi --- Im sorry but I cannot reproduce any of this issues. Frames load and playback as they should, remember we are loading the frames for animating, not for editing, so a lot more happens to prepare the pixel data to be composited. Notice that in my case I had no progressbar stuck at 99%. The buttons reported as not working work as expected, they are designed to help an animator to skip from keyframe to keyframe (they can work in 2's, 3's, etc): in your example the background layer had no keyframes, which makes the tool do nothing. krita (75bbbf6912b) SOFTWARE/OS VERSIONS macOS: 12.0.1 -- You are receiving this mail because: You are watching all bug changes.
[kwin] [Bug 445664] New: Cannot move tasks to activities from the panel
https://bugs.kde.org/show_bug.cgi?id=445664 Bug ID: 445664 Summary: Cannot move tasks to activities from the panel Product: kwin Version: 5.23.2 Platform: openSUSE RPMs OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: activities Assignee: kwin-bugs-n...@kde.org Reporter: szots...@gmail.com Target Milestone: --- STEPS TO REPRODUCE 1. Have a non-KDE/CSD window (like a browser) open 2. Have multiple activities available 3. Right click on the task manager entry of that window and choose "Show on activity", then choose a different activity to current one OBSERVED RESULT Nothing happens, when you right click again, the tick mark remains next to the same activity name as before and the window didn't get moved to the selected activity. Interestingly, it works for KDE/non-CSD windows when the same is tried from the title bar. EXPECTED RESULT Can move a CSD window to the selected activity. SOFTWARE/OS VERSIONS Operating System: openSUSE Tumbleweed 2021 KDE Plasma Version: 5.23.2 KDE Frameworks Version: 5.87.0 Qt Version: 5.15.2 Kernel Version: 5.14.6-1-default (64-bit) Graphics Platform: X11 ADDITIONAL INFORMATION Btw. I like the non-CSD title-bar solution much better because the local menu stays open during activity manipulation. -- You are receiving this mail because: You are watching all bug changes.
[LabPlot2] [Bug 445650] CAS worksheets fail to initialize in Labplot
https://bugs.kde.org/show_bug.cgi?id=445650 --- Comment #3 from optokine...@outlook.com --- (In reply to Stefan Gerlach from comment #2) I have Cantor installed, and it works fine! I have tried removing and reinstalling Cantor, Labplot and libcantorlibs, but Labplot CAS worksheets won't initialize even though Cantor works. -- You are receiving this mail because: You are watching all bug changes.
[valgrind] [Bug 445607] Unhandled amd64-freebsd syscall: 247
https://bugs.kde.org/show_bug.cgi?id=445607 --- Comment #4 from Paul Floyd --- I've pushed the change to resolve the missing syscall wrapper. Can you clone and build Valgrind (with the diff in my previous message) and also build debug versions of swi-pl and jemallloc? I'll also try to get in touch with the swi-pl maintainer. I'll leave this item open for the moment. -- You are receiving this mail because: You are watching all bug changes.
[LabPlot2] [Bug 445650] CAS worksheets fail to initialize in Labplot
https://bugs.kde.org/show_bug.cgi?id=445650 Stefan Gerlach changed: What|Removed |Added Assignee|alexander.se...@web.de |stefan.gerlach@uni-konstanz ||.de -- You are receiving this mail because: You are watching all bug changes.
[LabPlot2] [Bug 445650] CAS worksheets fail to initialize in Labplot
https://bugs.kde.org/show_bug.cgi?id=445650 Stefan Gerlach changed: What|Removed |Added CC||stefan.gerlach@uni-konstanz ||.de Resolution|--- |WAITINGFORINFO Status|REPORTED|NEEDSINFO --- Comment #2 from Stefan Gerlach --- Do you have cantor installed? On OpenSUSE just run a "zypper in -y cantor" to installed it. This package contains all the backends. Does this work for you? -- You are receiving this mail because: You are watching all bug changes.
[LabPlot2] [Bug 445650] CAS worksheets fail to initialize in Labplot
https://bugs.kde.org/show_bug.cgi?id=445650 --- Comment #1 from optokine...@outlook.com --- Running labplot2 from terminal and trying to create a worksheet will prompt the following: dir: "/usr/lib64/qt5/plugins/cantor/backends" dir: "/usr/bin/cantor/backends" Failed to load Cantor plugin: Cantor Part file name: The shared library was not found. -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] [Wayland] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 --- Comment #1 from poperi...@mailbox.org --- This also appears to happen with the notification drawer. -- You are receiving this mail because: You are watching all bug changes.
[neon] [Bug 445622] PackageKit selects KCoreAddons "5:5.86.0" over "5.88", breaking plasmashell 5.88 (unresolved symbol in PluginMetaData)
https://bugs.kde.org/show_bug.cgi?id=445622 --- Comment #10 from Andrew D'Addesio --- Okay, I installed neon-settings-2 and uninstalled kubuntu-desktop, and my system still boots and works like normal. Thanks for your help, @Jonathan Riddell -- You are receiving this mail because: You are watching all bug changes.
[plasmashell] [Bug 445663] New: [Wayland] Kickoff is maximized if Window placement is set to "Maximized"
https://bugs.kde.org/show_bug.cgi?id=445663 Bug ID: 445663 Summary: [Wayland] Kickoff is maximized if Window placement is set to "Maximized" Product: plasmashell Version: 5.23.3 Platform: Archlinux Packages OS: Linux Status: REPORTED Severity: normal Priority: NOR Component: Application Launcher (Kickoff) Assignee: k...@davidedmundson.co.uk Reporter: poperi...@mailbox.org CC: mikel5...@gmail.com, plasma-b...@kde.org Target Milestone: 1.0 SUMMARY If "Window management->Window behavior->Advanced->Window placement" is set to "Maximized", Kickoff is maximized. This also happens if you have a window rule that maximized all normal windows. This only happens in Wayland. X11 behaves as expected. STEPS TO REPRODUCE 1. Set "Window management->Window behavior->Advanced->Window placement" to "Maximized". 2. Open Kickoff. OBSERVED RESULT Kickoff is maximized. EXPECTED RESULT Kickoff is it's normal size. SOFTWARE/OS VERSIONS Operating System: EndeavourOS KDE Plasma Version: 5.23.3 KDE Frameworks Version: 5.88.0 Qt Version: 5.15.2 Kernel Version: 5.15.2-arch1-1 (64-bit) Graphics Platform: Wayland Processors: 8 × 11th Gen Intel® Core™ i5-1135G7 @ 2.40GHz Memory: 15.4 GiB of RAM Graphics Processor: Mesa Intel® Xe Graphics -- You are receiving this mail because: You are watching all bug changes.
[neon] [Bug 445622] PackageKit selects KCoreAddons "5:5.86.0" over "5.88", breaking plasmashell 5.88 (unresolved symbol in PluginMetaData)
https://bugs.kde.org/show_bug.cgi?id=445622 --- Comment #9 from Andrew D'Addesio --- Ah yes, after installing neon-settings-2 then doing another pkcon refresh+update, I see: $ sudo pkcon update Getting updates [=] Finished [=] Loading cache [=] Testing changes [=] Finished [ ] (0%) The following packages have to be downgraded: libkf5coreaddons-doc-5:5.86.0-0xneon+20.04+focal+release+build26.all KDE Frameworks 5 addons to QtCore (documentation) The following packages have to be updated: libnetplan0-0.103-0ubuntu5~20.04.3.amd64 YAML network configuration abstraction runtime library netplan.io-0.103-0ubuntu5~20.04.3.amd64YAML network configuration abstraction for various backends rsync-3.1.3-8ubuntu0.1.amd64 fast, versatile, remote (and local) file-copying tool Proceed with changes? [N/y which looks like it will successfully update (or what it calls "downgrade") "5:5.86.0" to "5.88.0". -- You are receiving this mail because: You are watching all bug changes.
[systemsettings] [Bug 432196] System Settings crashed while I was switching between KCMs
https://bugs.kde.org/show_bug.cgi?id=432196 --- Comment #4 from BEEDELL ROKE JULIAN LOCKHART --- Created attachment 143676 --> https://bugs.kde.org/attachment.cgi?id=143676=edit New crash information added by DrKonqi systemsettings5 (5.23.2) using Qt 5.15.2 - What I was doing when the application crashed: I did cease observation of "gtk3_preview" and the page that "gtk3_preview" had been invoked from – which was "Gnome/GTK Application Styles" – by switching to 1 different sub-page of the KConfig Module whose identifier is "Appearance" within "systemsettings5". - Unusual behavior I noticed: During observation of The Simple Desktop Display Manager during authentication before invocation of "systemsettings5", all custom configuration of it did appear to have been reverted after previous usage of it. -- Backtrace (Reduced): #6 0x7f835d98bb8e in std::__atomic_base::load (__m=std::memory_order_relaxed, this=0x71) at /usr/include/c++/11/bits/atomic_base.h:838 #7 std::atomic::load (__m=std::memory_order_relaxed, this=0x71) at /usr/include/c++/11/atomic:570 #8 QAtomicOps::loadRelaxed (_q_value=...) at ../../include/QtCore/../../src/corelib/thread/qatomic_cxx11.h:239 #9 QBasicAtomicPointer::loadRelaxed (this=0x71) at ../../include/QtCore/../../src/corelib/thread/qbasicatomic.h:248 #10 QObjectPrivate::ensureConnectionData (this=0x31) at kernel/qobject_p.h:371 -- You are receiving this mail because: You are watching all bug changes.
[systemsettings] [Bug 432196] System Settings crashed while I was switching between KCMs
https://bugs.kde.org/show_bug.cgi?id=432196 BEEDELL ROKE JULIAN LOCKHART changed: What|Removed |Added CC||beedellrokejulianlockhart@g ||mail.com -- You are receiving this mail because: You are watching all bug changes.
[lattedock] [Bug 439472] Latte dock crashes when attempting to add widgets
https://bugs.kde.org/show_bug.cgi?id=439472 --- Comment #10 from maplesp...@protonmail.com --- Created attachment 143675 --> https://bugs.kde.org/attachment.cgi?id=143675=edit New crash information added by DrKonqi latte-dock (0.10.3) using Qt 5.15.2 - What I was doing when the application crashed: I was removing the activity widget that I had just added on a panel I had just created and Latte crashed. I reopened Latte and added more widgets, but every time I added a widget Latte would crash. -- Backtrace (Reduced): #4 0x7f24f4400860 in QSGTexture::setFiltering(QSGTexture::Filtering) () at /usr/lib/libQt5Quick.so.5 #5 0x7f24f4431b3c in QSGOpaqueTextureMaterialShader::updateState(QSGMaterialShader::RenderState const&, QSGMaterial*, QSGMaterial*) () at /usr/lib/libQt5Quick.so.5 #6 0x7f24f441841a in QSGBatchRenderer::Renderer::renderMergedBatch(QSGBatchRenderer::Batch const*) () at /usr/lib/libQt5Quick.so.5 #7 0x7f24f441db96 in QSGBatchRenderer::Renderer::renderBatches() () at /usr/lib/libQt5Quick.so.5 #8 0x7f24f441e5a5 in QSGBatchRenderer::Renderer::render() () at /usr/lib/libQt5Quick.so.5 -- You are receiving this mail because: You are watching all bug changes.
[lattedock] [Bug 439472] Latte dock crashes when attempting to add widgets
https://bugs.kde.org/show_bug.cgi?id=439472 maplesp...@protonmail.com changed: What|Removed |Added CC||maplesp...@protonmail.com -- You are receiving this mail because: You are watching all bug changes.
[kdenlive] [Bug 440181] Add shortcut to hide/mute a track
https://bugs.kde.org/show_bug.cgi?id=440181 Julius Künzel changed: What|Removed |Added Version Fixed In||22.04.0 CC||jk.kde...@smartlab.uber.spa ||ce -- You are receiving this mail because: You are watching all bug changes.
[kdenlive] [Bug 440181] Add shortcut to hide/mute a track
https://bugs.kde.org/show_bug.cgi?id=440181 Julius Künzel changed: What|Removed |Added Status|REPORTED|RESOLVED Resolution|--- |FIXED Latest Commit||https://invent.kde.org/mult ||imedia/kdenlive/commit/8e5c ||0861b5ac0eb8e55aaacdde1cf70 ||34bcf0c89 --- Comment #2 from Julius Künzel --- Git commit 8e5c0861b5ac0eb8e55aaacdde1cf7034bcf0c89 by Julius Künzel. Committed on 17/11/2021 at 21:25. Pushed by jlskuz into branch 'master'. Make it possible to enable/disable track with a shortcut The default shortcut is Shift+H M +2-0src/mainwindow.cpp M +5-0src/project/projectmanager.cpp M +2-0src/project/projectmanager.h M +3-1src/timeline2/model/timelineitemmodel.cpp M +1-1src/timeline2/model/timelineitemmodel.hpp M +1-1src/timeline2/view/qml/TrackHead.qml M +12 -0src/timeline2/view/timelinecontroller.cpp M +1-0src/timeline2/view/timelinecontroller.h https://invent.kde.org/multimedia/kdenlive/commit/8e5c0861b5ac0eb8e55aaacdde1cf7034bcf0c89 -- You are receiving this mail because: You are watching all bug changes.
[neon] [Bug 445622] PackageKit selects KCoreAddons "5:5.86.0" over "5.88", breaking plasmashell 5.88 (unresolved symbol in PluginMetaData)
https://bugs.kde.org/show_bug.cgi?id=445622 --- Comment #8 from Andrew D'Addesio --- Here's what happens when I try to install it. daddesio@daddesio-HP-EliteDesk-800-G2-TWR:~$ sudo apt install neon-settings-2 [sudo] password for daddesio: Reading package lists... Done Building dependency tree Reading state information... Done Starting pkgProblemResolver with broken count: 1 Starting 2 pkgProblemResolver with broken count: 1 Investigating (0) kubuntu-settings-desktop:amd64 < 1:20.04.9 @ii mK Ib > Broken kubuntu-settings-desktop:amd64 Conflicts on neon-settings:amd64 < none @rc H > Conflicts//Breaks against version 0.0+p18.04+git20200805.1230 for neon-settings but that is not InstVer, ignoring Conflicts//Breaks against version 0.4+p20.04+trelease+git20210817.1407 for neon-settings-2 but that is not InstVer, ignoring Conflicts//Breaks against version 0.4+p20.04+trelease+git20210818.1110 for neon-settings-2 but that is not InstVer, ignoring Conflicts//Breaks against version 0.4+p20.04+trelease+git20210909.0907 for neon-settings-2 but that is not InstVer, ignoring Considering neon-settings-2:amd64 as a solution to kubuntu-settings-desktop:amd64 1 Removing kubuntu-settings-desktop:amd64 rather than change neon-settings:amd64 Investigating (0) kubuntu-desktop:amd64 < 1.398 @ii mK NPb Ib > Broken kubuntu-desktop:amd64 Depends on kubuntu-settings-desktop:amd64 < 1:20.04.9 @ii mR > Considering kubuntu-settings-desktop:amd64 1 as a solution to kubuntu-desktop:amd64 0 Removing kubuntu-desktop:amd64 rather than change kubuntu-settings-desktop:amd64 Done The following package was automatically installed and is no longer required: libkf5coreaddons-doc Use 'sudo apt autoremove' to remove it. The following packages will be REMOVED: kubuntu-desktop kubuntu-settings-desktop The following NEW packages will be installed: neon-settings-2 0 upgraded, 1 newly installed, 2 to remove and 0 not upgraded. Need to get 40.7 kB of archives. After this operation, 494 kB disk space will be freed. Do you want to continue? [Y/n] n Abort. Note that I manually installed kubuntu-desktop last year, since my system broke during the Neon 18.04 -> Neon 20.04 update and the easiest "fix" at the time was manually installing kubuntu-desktop (which I thought was a metapackage that reinstalled all the KDE apps). -- You are receiving this mail because: You are watching all bug changes.
[neon] [Bug 445622] PackageKit selects KCoreAddons "5:5.86.0" over "5.88", breaking plasmashell 5.88 (unresolved symbol in PluginMetaData)
https://bugs.kde.org/show_bug.cgi?id=445622 --- Comment #7 from Andrew D'Addesio --- I don't have that installed, but it's available in apt. -- You are receiving this mail because: You are watching all bug changes.
[korganizer] [Bug 418811] Events stored in the database not displayed in KOrganizer
https://bugs.kde.org/show_bug.cgi?id=418811 --- Comment #7 from emil.ostw...@gmx.net --- And another example. Changed the DAVx5 account name to something without an '@'. The organizer email address is filled with this account name. Now there is only the attendee I added to the event and not the organizer again as second attendee: BEGIN:VCALENDAR PRODID:-//K Desktop Environment//NONSGML libkcal 4.3//EN VERSION:2.0 X-KDE-ICAL-IMPLEMENTATION-VERSION:1.0 BEGIN:VEVENT ORGANIZER:MAILTO:nameCloudServer DTSTAMP:2027T202723Z ATTENDEE;RSVP=TRUE;PARTSTAT=NEEDS-ACTION;ROLE=REQ-PARTICIPANT; CUTYPE=INDIVIDUAL;X-UID=93951310843280:mailto:m...@me.com CREATED:2027T202723Z UID:1db96c2b-6df8-41b2-b607-8fac529553d3 LAST-MODIFIED:2027T202723Z SUMMARY:Test H new 4 STATUS:CONFIRMED DTSTART;TZID=Europe/Berlin:2029T10 DTEND;TZID=Europe/Berlin:2029T11 TRANSP:OPAQUE BEGIN:VALARM DESCRIPTION:Test H new 4 ACTION:DISPLAY TRIGGER:-P1D X-KDE-KCALCORE-ENABLED:TRUE END:VALARM END:VEVENT BEGIN:VTIMEZONE TZID:Europe/Berlin BEGIN:DAYLIGHT TZNAME:CEST TZOFFSETFROM:+ TZOFFSETTO:+0200 DTSTART:19800406T01 RDATE:19800406T01 END:DAYLIGHT BEGIN:STANDARD TZNAME:CET TZOFFSETFROM:+0200 TZOFFSETTO:+0100 DTSTART:19971026T03 RRULE:FREQ=YEARLY;BYDAY=-1SU;BYMONTH=10 END:STANDARD BEGIN:STANDARD TZNAME:CET TZOFFSETFROM:+0200 TZOFFSETTO:+0100 DTSTART:19800928T03 RRULE:FREQ=YEARLY;UNTIL=19961027T03;BYDAY=-1SU;BYMONTH=9 RDATE:19950924T03 END:STANDARD BEGIN:DAYLIGHT TZNAME:CEST TZOFFSETFROM:+0100 TZOFFSETTO:+0200 DTSTART:19810329T02 RRULE:FREQ=YEARLY;BYDAY=-1SU;BYMONTH=3 END:DAYLIGHT END:VTIMEZONE END:VCALENDAR -- You are receiving this mail because: You are watching all bug changes.
[valgrind] [Bug 445607] Unhandled amd64-freebsd syscall: 247
https://bugs.kde.org/show_bug.cgi?id=445607
--- Comment #3 from Paul Floyd ---
If I increase the brk segment from 8M to 1G that part of the message goes away,
but the other parts remain.
The diff to do that is
diff --git a/coregrind/m_initimg/initimg-freebsd.c
b/coregrind/m_initimg/initimg-freebsd.c
index d19186a42..59c2f4f85 100644
--- a/coregrind/m_initimg/initimg-freebsd.c
+++ b/coregrind/m_initimg/initimg-freebsd.c
@@ -891,7 +891,7 @@ IIFinaliseImageInfo VG_(ii_create_image)( IICreateImageInfo
iicii,
//--
{
SizeT m1 = 1024 * 1024;
- SizeT m8 = 8 * m1;
+ SizeT m8 = 8 * m1 * 128;
SizeT dseg_max_size = (SizeT)VG_(client_rlimit_data).rlim_cur;
VG_(debugLog)(1, "initimg", "Setup client data (brk) segment\n");
if (dseg_max_size < m1) dseg_max_size = m1;
Note that questions about this arise frequently. This has to be hard coded as
it is really early in the tool startup, and it is not yet possible to parse
command line arguments or read environment variables.
--
You are receiving this mail because:
You are watching all bug changes.
