Dear Xi,
It may be more useful to rewrite your code to take advantage of perl6.
Your revcom can be replaced with a single line using core perl6 functions.
I'll give an example that currently works on rakudo for a simple string,
but you can put it into the loop.
my $sq='ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgta';
say $sq.trans(['A','T','G','C','a','t','g','c'] =>
['T','A','C','G','t','a','c','g']).reverse;
Really so simple. And probably much faster. The advantage over your
revcom subroutine is that it is much easier to understand.
Richard
On 06/13/10 10:03, Xi Yang wrote:
> #!/usr/bin/perl6use
> v6;use Bio::SeqIO;
> say "program initialized";my $IN = Bio::SeqIO.new('fasta','makeseq.fasta');
> say "input stream created";
> while (my $obj = $IN.next_seq) { say "\tid: <",$obj.display_id,">";
> say "\tseq: <{$obj.seq}>"; say "\trev: <{revcom($obj.seq)}>";}
> sub revcom(Str $seq) {my $len = $seq.chars; my $result; loop
> (my $i=$len-1; $i>=0; $i--) { given ($seq.substr($i,1)) {
> when ('A') {$result~='T'} when ('T')
> {$result~='A'} when ('G') {$result~='C'}
>when ('C') {$result~='G'} when ('a')
> {$result~='t'} when ('t') {$result~='a'}
>when ('g') {$result~='c'} when ('c')
> {$result~='g'} } } return
> $result;}
> #!/usr/bin/perl
> use strict;use Bio::SeqIO;use feature qw/say switch/;
> say "program initialized";
> my $IN = Bio::SeqIO->new(-file=>'makeseq.fasta');
> say "input stream created";
> while (my $obj = $IN->next_seq) {say "\tid: <",$obj->display_id,">";
> say "\tseq: <",$obj->seq,">";say "\trev: <",revcom($obj->seq),">";}
> sub revcom { my $seq = shift;my $len = length $seq; my $result;
> for (my $i=$len-1; $i>=0; $i--) { given (substr $seq,$i,1) {
> when ('A') {$result.='T'} when ('T')
> {$result.='A'} when ('G') {$result.='C'}
>when ('C') {$result.='G'} when ('a')
> {$result.='t'} when ('t') {$result.='a'}
>when ('g') {$result.='c'} when ('c')
> {$result.='g'} } } return $result;}
> >EMBOSS_001ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgtaacgtagcgctccactccgttcgaaaggccggaggaaacaatcgctgaacaactgggtagacataaccatgtcgtctctgtgctactcccccacgggtatattaaggcagataaggttgcttagtgggacctataac>EMBOSS_002cggattcagaattggacccggaagcatgcaggcgtggaatgtgggttaagggaccgaagtatttcgttactattccgatagtatccgatgagtccgtagcgggatgcacgtcataatcctagccttgaacgaccgggtactggttacgcaattccacccatgtaccttcccacagcccacatgcgacttatt>EMBOSS_003tctacgtatgggaataggacgtgctcaatacacgcatggcttgccgtccatcgggagcgttgcaagtcaaagagctaggcttaacctggactgagtggtcattgcgccgatgcacggcctgcctcagcgctgggagtaatcgtcaatagcaagtgtattgtagcgtcatcccaggcctcgaggcctaa>EMBOSS_004gttgccgaacgcgccactctcccgcggtgcttaatcgagttggactcaccacctaccacacaacaccggatgcgctaactccgggcatctgtcgcaaggcttcatggaaccctacactggtaatcatggtaatagattcaacgtgggttccgttcatatagacaccactcacaaaggcgttcgtgccctgat>EMBOSS_005atatcactcagcctgtggacgtgagccacccgcgctcactctcgctgtagattatgtcg
>
> gggagagaacgtagaatctgtaatcatcggtcatatgaagtaatccaccgacaccgagcaacgttgctactgacaacgggacatttaagagtgctggaaattgagttattccgcctggataattggcggtttg
>
>
