[R] document methods in Reference Classes
Dear all, I would like to get informations on how to document Reference Classes. I noticed that for every normal S4 method there is normally a corresponding .Rd file in the man directory of the package. Is this valid also for methods of the reference classes ? Apparently the package.skeleton function do NOT generate those files automatically for methods of a reference class. Am I supposed to create those files manually ? Thx a lot for the help, Best Regards, Andrea Franceschini [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] write merged data frame to a file
Very Sorry for the instinctive bad comment... I didn't express correctly what I meant. I meant that I would have never expected such behaviour, by default (but may be I am wrong and most of the people need quoting, and hence has sense to put it by default) Problem solved, Philipp guessed right. It was just a quoting problem on the gene description. The problem could be solved simply adding the (quote=) parameter to the read.table command. The quoting problem reversed into that strange behavior when I merged two table (I don't know why). Thankyou very much for the assistance, Now that I realized that the quoting exists I can enjoying using R (that as a tool perfectly suits my needs at the moment). Have a nice day, Andrea On Mon, Jul 18, 2011 at 7:36 PM, David Winsemius dwinsem...@comcast.net wrote: On Jul 18, 2011, at 11:10 AM, Andrea Franceschini wrote: Dear Philipp, You were right, thankyou very much. Effectively the second read.table didn't work (probably because of the strange characters). From my point of view this is a very bad R bug. When I read this I thought it was an example of a young person just starting their education exhibiting Piaget's preoperational stage when applied to the task of learning a computer language. the child begins to use symbols to represent objects. Early in this stage he also personifies objects. [snipped] His thinking is influenced by fantasy -- the way he'd like things to be -- and he assumes that others see situations from his viewpoint. [Copied from a webpage for grade school teachers: http://www2.honolulu.hawaii.edu/facdev/guidebk/teachtip/piaget.htm ] But when I do a search in PubMed, I find that you may be an established researcher, so I thing the onus is now on you to demonstrate how R's behavior is different than the documented design goals for the read.table function. I precisely inserted the \t separator in the read table command, hence I would expect that everything is working. How can I make it work ??? I thought Pagel already gave you the answer, but your response is too general to be sure. What exactly did you find and can you provide a minimal code and data example that illustrates how read.table is acting in any way different than the documentation describes? -- David. Effectively there are several ' (i.e. apostrophe) characters in the file. I guess are those that confuse R Thankyou very much, Best Regards, Andrea On Mon, Jul 18, 2011 at 4:32 PM, Philipp Pagel p.pa...@wzw.tum.de wrote: On Mon, Jul 18, 2011 at 04:00:29PM +0200, Andrea Franceschini wrote: I use version 13 of R in OSX (downloaded and installed less than 1 year ago). Probably 2.13 ... [...] code omitted The first lines are OK (i.e. 14 columns, like the dataframe), while at a certain point I get lines with only 3 columns !!! The bad lines that contain only 3 columns have the name and the description of the gene (i.e. the content of the file that I merged with). Besides, these strange lines also get repeated (see the bottom). I havent't carefully analyzed your code so I may be wrong but my guess for all weird behaviour of gene related data.frames problems is this: Gene descriptions love to contain things like Foo 5' obfuscation factor. Note the ' in the description which read.table will happily interpret as a quotation mark and eat lots of rows until it happens to encouter a closing counterpart. This leads to all kinds of funny results. So I bet your problem is not in write.table but in reading the data. Have a closer look at your data frame: are you really getting the expected number of observations in the merged data.frame? Are the rows in question really ok in the data frame? If my guess is correct you should be able to fix your problem by including quote= in both your read.table commands. If it doesn't, also try comment.char= - another popular source of problems. cu Philipp -- Dr. Philipp Pagel Lehrstuhl für Genomorientierte Bioinformatik Technische Universität München Wissenschaftszentrum Weihenstephan 85350 Freising, Germany http://webclu.bio.wzw.tum.de/~pagel/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. David Winsemius, MD West Hartford, CT __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] write merged data frame to a file
Dear all, I merged 2 data frames using the merged command and the resulting data frame looks perfect into R. However, I have serious problems when I try to write this new data frame into a file using the write.table command. Basically I get parts of the second file that I merged into the file. What could it be the problem ? Thankyou very much, Best Regards, Andrea -- View this message in context: http://r.789695.n4.nabble.com/write-merged-data-frame-to-a-file-tp3674924p3674924.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] write merged data frame to a file
homeobox B6 3217HOXB7 homeobox B7 3218HOXB8 homeobox B8 3219HOXB9 homeobox B9 3220HOXC@ homeobox C cluster 3221HOXC4 homeobox C4 3222HOXC5 homeobox C5 3223HOXC6 homeobox C6 3224HOXC8 homeobox C8 3225HOXC9 homeobox C9 3226HOXC10 homeobox C10 3227HOXC11 homeobox C11 3228HOXC12 homeobox C12 3229HOXC13 homeobox C13 3230HOXD@ homeobox D cluster 3231HOXD1 homeobox D1 3232HOXD3 homeobox D3 3233HOXD4 homeobox D4 3234HOXD8 homeobox D8 3235HOXD9 homeobox D9 3236HOXD10 homeobox D10 3237HOXD11 homeobox D11 3238HOXD12 homeobox D12 3239HOXD13 homeobox D13 3240HP haptoglobin 3241HPCAL1 hippocalcin-like 1 3242HPD 4-hydroxyphenylpyruvate dioxygenase 3244HPE1holoprosencephaly 1, alobar 3247HPFH2 hereditary persistence of fetal hemoglobin, heterocellular, Indian type 3248HPGDhydroxyprostaglandin dehydrogenase 15-(NAD) 3249HPN hepsin 3250HPR haptoglobin-related protein 3251HPRT1 hypoxanthine phosphoribosyltransferase 1 3254HPRTP2 hypoxanthine phosphoribosyltransferase pseudogene 2 3255HPRTP3 hypoxanthine phosphoribosyltransferase pseudogene 3 3257HPS1Hermansky-Pudlak syndrome 1 3258HPT hypoparathyroidism 3259HPV6AI1 human papillomavirus (type 6a) integration site 1 3260HPV18I1 human papilloma virus (type 18) integration site 1 3261HPV18I2 human papillomavirus (type 18) integration site 2 3262HPVC1 human papillomavirus (type 18) E5 central sequence-like 1 3263HPX hemopexin 3265HRASv-Ha-ras Harvey rat sarcoma viral oncogene homolog 3266ERASES cell expressed Ras 3267AGFG1 ArfGAP with FG repeats 1 3268AGFG2 ArfGAP with FG repeats 2 3269HRH1histamine receptor H1 3270HRC histidine rich calcium binding protein 3272HRES1 HTLV-1 related endogenous sequence 3273HRG histidine-rich glycoprotein 3274HRH2histamine receptor H2 3275PRMT2 protein arginine methyltransferase 2 3276PRMT1 protein arginine methyltransferase 1 3278HRPT1 hyperparathyroidism 1 3280HES1hairy and enhancer of split 1, (Drosophila) 3281HSBP1 heat shock factor binding protein 1 3283HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 3284HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 3290HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 3291HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 3292HSD17B1 hydroxysteroid (17-beta) dehydrogenase 1 3293HSD17B3 hydroxysteroid (17-beta) dehydrogenase 3 3294HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 3295HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 3297HSF1heat shock transcription factor 1 3298HSF2heat shock transcription factor 2 3299HSF4heat shock transcription factor 4 3300DNAJB2 DnaJ (Hsp40) homolog, subfamily B, member 2 3301DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 3303HSPA1A heat shock 70kDa protein 1A 3304HSPA1B heat shock 70kDa protein 1B 3305HSPA1L heat shock 70kDa protein 1-like 3306HSPA2 heat shock 70kDa protein 2 3308HSPA4 heat shock 70kDa protein 4 3309HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) 3310HSPA6 heat shock 70kDa protein 6 (HSP70B) 31880.7339296 1242SI00439852 425 3319 UGUAGCUCUAACGAUACCGGG GUAGCU GUAGCUC 0.69809605 1541HNRNPH2 heterogeneous nuclear ribonucleoprotein H2 (H) 3189HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) 3190HNRNPK heterogeneous nuclear ribonucleoprotein K 3191HNRNPL heterogeneous nuclear ribonucleoprotein L 3192HNRNPU heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) 3193HOAChypoacusis 2 (autosomal recessive) 3195TLX1T-cell leukemia homeobox 1 3196TLX2T-cell leukemia homeobox 2 3197HOXA@ homeobox A cluster 3198HOXA1 homeobox A1 3199HOXA2 homeobox A2 3200HOXA3 homeobox A3 3201HOXA4 homeobox A4 Thankyou very much, Best Regards, Andrea On Mon, Jul 18, 2011 at 2:45 PM, Sarah Goslee sarah.gos...@gmail.com wrote: Hi Andrea, On Mon, Jul 18, 2011 at 6:07 AM, Andrea Franceschini ata...@gmail.com wrote: Dear all, I merged 2 data frames using the merged command and the resulting data frame looks perfect into R. However, I have serious problems when I try to write this new data frame into a file using the write.table command. Basically I get parts of the second file that I merged into the file. What could it be the problem ? I have no idea. What did you do? What does your new data frame look like? What commands did you issue? What result did you get? What result did you expect? Can you provide a small reproducible example, or at least a great deal more information? str() is a good
Re: [R] write merged data frame to a file
Dear Philipp, You were right, thankyou very much. Effectively the second read.table didn't work (probably because of the strange characters). From my point of view this is a very bad R bug. I precisely inserted the \t separator in the read table command, hence I would expect that everything is working. How can I make it work ??? Effectively there are several ' (i.e. apostrophe) characters in the file. I guess are those that confuse R Thankyou very much, Best Regards, Andrea On Mon, Jul 18, 2011 at 4:32 PM, Philipp Pagel p.pa...@wzw.tum.de wrote: On Mon, Jul 18, 2011 at 04:00:29PM +0200, Andrea Franceschini wrote: I use version 13 of R in OSX (downloaded and installed less than 1 year ago). Probably 2.13 ... [...] code omitted The first lines are OK (i.e. 14 columns, like the dataframe), while at a certain point I get lines with only 3 columns !!! The bad lines that contain only 3 columns have the name and the description of the gene (i.e. the content of the file that I merged with). Besides, these strange lines also get repeated (see the bottom). I havent't carefully analyzed your code so I may be wrong but my guess for all weird behaviour of gene related data.frames problems is this: Gene descriptions love to contain things like Foo 5' obfuscation factor. Note the ' in the description which read.table will happily interpret as a quotation mark and eat lots of rows until it happens to encouter a closing counterpart. This leads to all kinds of funny results. So I bet your problem is not in write.table but in reading the data. Have a closer look at your data frame: are you really getting the expected number of observations in the merged data.frame? Are the rows in question really ok in the data frame? If my guess is correct you should be able to fix your problem by including quote= in both your read.table commands. If it doesn't, also try comment.char= - another popular source of problems. cu Philipp -- Dr. Philipp Pagel Lehrstuhl für Genomorientierte Bioinformatik Technische Universität München Wissenschaftszentrum Weihenstephan 85350 Freising, Germany http://webclu.bio.wzw.tum.de/~pagel/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] hypergeometric vs fisher.test
Dear R team, I have a simple question. I tried this command: phyper(17,449,19551,181, FALSE) [1] 1.47295e-07 and then I tried this command: (fisher.test(matrix(c(17,449,181,19551),2,2), alternative='greater'))$p.value [1] 3.693347e-06 Shouldn't be identical the results of the two commands ? What is the difference ? Thx a lot -- View this message in context: http://r.789695.n4.nabble.com/hypergeometric-vs-fisher-test-tp2324223p2324223.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] hypergeometric vs fisher.test
I ask the question also because I found this line in Wikipedia: The test (see above) based on the hypergeometric distribution (hypergeometric test) is identical to the corresponding one-tailed version of Fisher's exact test. Is this wrong ? May I kindly ask a friendly explanation for not-experts in statistics ? Thx a lot, -- View this message in context: http://r.789695.n4.nabble.com/hypergeometric-vs-fisher-test-tp2324223p2324429.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
