Re: [R] How to load fasta file with openPrimeR?
Thank you. it looks like it worked:
```
> fasta.file <- "stx.fa"
> seq.df <- read_templates(fasta.file)
> fasta.file
[1] "stx.fa"
> seq.df
ID Header Group Identifier
Sequence_Length Allowed_Start_fw Allowed_End_fw
1 >MW311073.1 Escheric... >MW311073.1 Escheric... default 1
1801 30
Allowed_Start_rev Allowed_End_rev Allowed_fw
Allowed_rev Allowed_Start_fw_ali
1 151 180 atgaagaagatgtttatggc...
cgctggaatctgcaaccgtt...1
Allowed_End_fw_ali Allowed_Start_fw_initial Allowed_End_fw_initial
Allowed_Start_fw_initial_ali
1 301 30
1
Allowed_End_fw_initial_ali Allowed_Start_rev_ali Allowed_End_rev_ali
Allowed_Start_rev_initial
1 30 151 180
151
Allowed_End_rev_initial Allowed_Start_rev_initial_ali
Allowed_End_rev_initial_aliSequence
1 180 151
180 atgaagaagatgtttatggc...
InputSequence Run
1 atgaagaagatgtttatggc... stx
```
When the original file stx.fa is:
```
>MW311073.1 Escherichia coli strain XP2F shiga toxin 2 (stx2) gene, partial cds
ATGAAGAAGATGTTTATGGCGGATTTGCATTAGTTTCTGTTAATGCAATGGCGGCGGATTGCGCTA
AAGGTTTGAGCCAAGTATAATGAGAATGATACATTCACAGTGTGGCCGGGAGTA
CTGGACCAGTCGCTGGAATCTGCAACCGTTACTGCAAAGT
```
On Mon, Feb 15, 2021 at 7:28 PM Bill Dunlap wrote:
>
> > but if I give these commands to a local file:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> > "stx.fa", package = "openPrimeR")
> > fasta.file <- system.file("stx.fa", package = "openPrimeR")
> > ```
> > where stx.fa il the file I wanted to open and that is present in the
> > working directly. I get only an empty object.
>
> If "stx.fa" is in fact in the current working directory then use
>fasta.file <- "stx.fa"
> system.file() is for accessing files in installed packages.
>
> -Bill
>
> On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu
> wrote:
> >
> > Hello,
> > I am trying to load a fast file with the package 'openPrimeR'. The
> > manual
> > (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html)
> > says to use:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> > "Homo_sapiens_IGH_functional_exon.fasta", package =
> > "openPrimeR")
> > # Load the template sequences from 'fasta.file'
> > seq.df.simple <- read_templates(fasta.file)
> > ```
> > but if I give these commands to a local file:
> > ```
> > fasta.file <- system.file("extdata", "IMGT_data", "templates",
> > "stx.fa", package = "openPrimeR")
> > fasta.file <- system.file("stx.fa", package = "openPrimeR")
> > ```
> > where stx.fa il the file I wanted to open and that is present in the
> > working directly. I get only an empty object.
> > What am I getting wrong?
> > Thank you
> >
> >
> > --
> > Best regards,
> > Luigi
> >
> > __
> > R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
> > https://stat.ethz.ch/mailman/listinfo/r-help
> > PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> > and provide commented, minimal, self-contained, reproducible code.
--
Best regards,
Luigi
__
R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] How to load fasta file with openPrimeR?
I think the problem is system.file, which is R base, but I'll go for
bioconductor. Thanks
On Mon, Feb 15, 2021 at 7:18 PM Bert Gunter wrote:
>
> As this is a Bioconductor package, why not ask on their support page:
>
> https://support.bioconductor.org/
>
>
>
> Bert Gunter
>
> "The trouble with having an open mind is that people keep coming along and
> sticking things into it."
> -- Opus (aka Berkeley Breathed in his "Bloom County" comic strip )
>
>
> On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu
> wrote:
>>
>> Hello,
>> I am trying to load a fast file with the package 'openPrimeR'. The
>> manual
>> (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html)
>> says to use:
>> ```
>> fasta.file <- system.file("extdata", "IMGT_data", "templates",
>> "Homo_sapiens_IGH_functional_exon.fasta", package =
>> "openPrimeR")
>> # Load the template sequences from 'fasta.file'
>> seq.df.simple <- read_templates(fasta.file)
>> ```
>> but if I give these commands to a local file:
>> ```
>> fasta.file <- system.file("extdata", "IMGT_data", "templates",
>> "stx.fa", package = "openPrimeR")
>> fasta.file <- system.file("stx.fa", package = "openPrimeR")
>> ```
>> where stx.fa il the file I wanted to open and that is present in the
>> working directly. I get only an empty object.
>> What am I getting wrong?
>> Thank you
>>
>>
>> --
>> Best regards,
>> Luigi
>>
>> __
>> R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
>> https://stat.ethz.ch/mailman/listinfo/r-help
>> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
>> and provide commented, minimal, self-contained, reproducible code.
--
Best regards,
Luigi
__
R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] How to load fasta file with openPrimeR?
> but if I give these commands to a local file:
> ```
> fasta.file <- system.file("extdata", "IMGT_data", "templates",
> "stx.fa", package = "openPrimeR")
> fasta.file <- system.file("stx.fa", package = "openPrimeR")
> ```
> where stx.fa il the file I wanted to open and that is present in the
> working directly. I get only an empty object.
If "stx.fa" is in fact in the current working directory then use
fasta.file <- "stx.fa"
system.file() is for accessing files in installed packages.
-Bill
On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu
wrote:
>
> Hello,
> I am trying to load a fast file with the package 'openPrimeR'. The
> manual
> (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html)
> says to use:
> ```
> fasta.file <- system.file("extdata", "IMGT_data", "templates",
> "Homo_sapiens_IGH_functional_exon.fasta", package =
> "openPrimeR")
> # Load the template sequences from 'fasta.file'
> seq.df.simple <- read_templates(fasta.file)
> ```
> but if I give these commands to a local file:
> ```
> fasta.file <- system.file("extdata", "IMGT_data", "templates",
> "stx.fa", package = "openPrimeR")
> fasta.file <- system.file("stx.fa", package = "openPrimeR")
> ```
> where stx.fa il the file I wanted to open and that is present in the
> working directly. I get only an empty object.
> What am I getting wrong?
> Thank you
>
>
> --
> Best regards,
> Luigi
>
> __
> R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.
__
R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] How to load fasta file with openPrimeR?
As this is a Bioconductor package, why not ask on their support page:
https://support.bioconductor.org/
Bert Gunter
"The trouble with having an open mind is that people keep coming along and
sticking things into it."
-- Opus (aka Berkeley Breathed in his "Bloom County" comic strip )
On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu
wrote:
> Hello,
> I am trying to load a fast file with the package 'openPrimeR'. The
> manual (
> https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html
> )
> says to use:
> ```
> fasta.file <- system.file("extdata", "IMGT_data", "templates",
> "Homo_sapiens_IGH_functional_exon.fasta", package =
> "openPrimeR")
> # Load the template sequences from 'fasta.file'
> seq.df.simple <- read_templates(fasta.file)
> ```
> but if I give these commands to a local file:
> ```
> fasta.file <- system.file("extdata", "IMGT_data", "templates",
> "stx.fa", package = "openPrimeR")
> fasta.file <- system.file("stx.fa", package = "openPrimeR")
> ```
> where stx.fa il the file I wanted to open and that is present in the
> working directly. I get only an empty object.
> What am I getting wrong?
> Thank you
>
>
> --
> Best regards,
> Luigi
>
> __
> R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
> https://stat.ethz.ch/mailman/listinfo/r-help
> PLEASE do read the posting guide
> http://www.R-project.org/posting-guide.html
> and provide commented, minimal, self-contained, reproducible code.
>
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list -- To UNSUBSCRIBE and more, see
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
