Re: [Tutor] ftplib: retrbinary all files in directory

[Rich Krauter]

Israel Carr wrote:
> I'm using ftplib to connect to a server, and I want to grab every file
> from a specific folder.  The filenames change frequently.  What is the
> best way to use retrbinary with wildcards(or some better option) to
> transfer all files?
> 
> Thanks,
> Israel
> 
> ___
> Tutor maillist  -  Tutor@python.org
> http://mail.python.org/mailman/listinfo/tutor
> 

You can try ftpmirror.py, which is included with python.

 From http://docs.python.org/lib/module-ftplib.html:
"""
The file Tools/scripts/ftpmirror.py  in the Python source distribution 
is a script that can mirror FTP sites, or portions thereof, using the 
ftplib module. It can be used as an extended example that applies this 
module.
"""

Good luck.

Rich

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Class and Scope Question

[Rich Krauter]

Tim Johnson wrote:
> The following test script is kind of got me baffled:
> #!/usr/local/bin/python
> class Eval:
> def __getitem__(self,key):
> return eval(key)
> ##def test():
> ##  i = 100
> ##  b = ["My", "name", "is", "Tim"]
> ##  test = "this is number %(str(i))s for a test %(' '.join(b))s"
> ##  s = test % Eval()
> ##  print s
> ##test()
> i = 100
> b = ["My", "name", "is", "Tim"]
> test = "this is number %(str(i))s for a test %(' '.join(b))s"
> print test % Eval()
> ## 
> Running this gives me the following :
> [EMAIL PROTECTED] baker]$ python test.py
> this is number 100 for a test My name is Tim
> ## cool!
> Now if I comment out the last four lines and uncomment
> the previous 7, I get the following error message:
> [EMAIL PROTECTED] baker]$ python test.py
> Traceback (most recent call last):
>   File "test.py", line 11, in ?
> test()
>   File "test.py", line 9, in test
> s = test % Eval()
>   File "test.py", line 4, in __getitem__
> return eval(key)
>   File "", line 0, in ?
> NameError: name 'i' is not defined
> ## It's been a llnngg day. What am I missing here?
> Explanation and solution is no doubt going to further edify
> me about python.
> 
> TIA
> tim
> 

Tim,

http://aspn.activestate.com/ASPN/Cookbook/Python/Recipe/66018 has a more 
general solution in the comments at the bottom. Basically, you need to 
put an __init__ in the Eval class, pass locals() and globals() to it, 
and use those passed-in values in your call to the eval() built-in.

I believe the result you see is due to python's lexical scoping rules. 
Scope is determined by a function- or class-definition's position in the 
text of the program.



def f():
 x = 20
 def g():
 print x
 g()

def h():
 x = 50
 i()

def i():
 print x

if __name__ == '__main__':
 f() # works
 h() # doesn't work



Here's another example:


g = 'module level'

class A:
 def print_locals_and_globals(self):
 for k,v in locals().items()+globals().items():
 print k,v

def func():
 # a couple names that won't appear
 # in a's locals or globals
 i = 10
 s = 'a string'

 a = A()
 a.print_locals_and_globals()

if __name__ == '__main__':
 func()



So it seems the locals and globals visible to an instance of a class is 
determined by where the class is defined, not by where the instance is 
created.

HTH,

Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] design questions: pythonic approach to ostriches

[Rich Krauter]

Brian van den Broek wrote:
Hi all,
I am wondering about the Pythonic way to handle the problem of 
ostriches, emus, and penguins. (I cannot recall from where I got the 
example.)

Here's what I mean:
class Bird(object):
def fly(self):
# flying logic here
def lay(self):
# egg-laying logic here
# more bird methods
class Ostrich(Bird):
# ostriches can't fly, so what to do?
I've explored a number of solutions; here they are with what I see as to 
cons and problems:

The simplest thing is to emulate the ostrich and pretend the problem 
doesn't exist. But, putting one's head in the sand looks likely to cause 
troubles in that this route break encapsulation, requiring callers to 
know enough not to call the fly method of an ostrich. So, that's no good.

class Ostrich(Bird):
def fly(self):
pass
seems only marginally better, in that it gives the external appearance 
of flight, whereas what is needed is a "Hey, I don't fly" signal.

The next thought was to over-ride Ostrich.fly as
def fly(self):
 raise NotImplementedError
That seems better, but also a bit confusing; the way I understand it, 
NotImplementedError is, in the first instance, for abstract classes or 
for marking work in progress. But Ostrich.fly doesn't fit either case.

That makes me think to define a custom exception, say
class OstrichError(NotImplementedError):
'''A custom exception for cases of the "Ostrich problem".
Intended to be raised by methods in a subclass over-riding methods
of the parent which don't make sense for the subclass to actually
implement.'''
def __init__(self):
NotImplementedError.__init__(self)
But, since the problem isn't one that my penetrating genius discovered, 
I am inclined to think that were this the ideal solution, there'd be a 
(better named) exception class builtin to Python already.

A complicated class hierarchy like
class Bird(object):
# bird logic
class FlyingBird(Bird):
def fly(self):
# flying logic here
class FlightlessBird(Bird):
# any particularly flightless logic here
class Ostrich(FlightlessBird):
# ostrich logic
seems an invitation to difficulty. My analogy will soon break, but some 
birds build nests and sing, others, no so much, etc. Flat is soon to 
give way to deeply nested.

I also tried to delete the inherited Bird.fly method within 
Ostrich.__init__, but

class Ostrich(Bird):
def __init__(self):
del self.__dict__['fly']
raises a KeyError, whereas
def __init__(self):
del Ostrich.__dict__['fly']
raises:
TypeError: object does not support item deletion
Do I have the syntax of the last approach wrong? Or is there no way to 
remove a method from a class? If the latter, what to do about flightless 
fowl?

Thanks and best,
Brian vdB

Brian,
I've seen the strategy pattern used in this kind of scenario. Your 
strategies can be encapulated classes, and methods within the Bird 
classes delegate to the strategy classes - so you achieve desired 
behavior though composition, rather than inheritance.

Here's a quick example (which doesn't really address any of your 
questions and probably has its own problems):

class CantFly(object):
def fly(self):
print "I can't fly"
class CanFly(object):
def fly(self):
print "I can fly"
class Bird(object):
def __init__(self,flightBehavior):
self.flightBehavior = flightBehavior
def fly(self):
self.flightBehavior.fly()
b1 = Bird(CantFly())
b2 = Bird(CanFly())
for b in (b1,b2):
b.fly()
Good luck.
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] iterator question for a toy class

[Rich Krauter]

Kent Johnson wrote:
Rich Krauter wrote:
2) Or, if you really want your __eq__ method to use the iterator 
returned by __iter__(),

def __eq__(self, other):
for i, j in map(None,self, other):
if i != j:
return False
return True

That's not right either, it will compare Foo([None], []) == Foo([], []) 
for example.
Kent,
Yikes, I should have seen that. Thanks for pointing out the error.
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] iterator question for a toy class

[Rich Krauter]

Marcus Goldfish wrote:
I'm trying to understand custom iterators in Python, and created the
following toy class for sequence comparison, which seems to work:
class Foo(object):
   """A toy class to experiment with __eq__ and __iter__"""
   def __init__(self, listA, listB):
  self.head, self.tail = listA, listB
   def __iter__(self):
  return iter(self.head[:]+self.tail[:])
   def __eq__(self, other):
  """Foo instances are equal if their respective subsequences,
  head, tail, are in the same order"""
  diff = [i for i, j in zip(self, other) if i != j]
  return len(diff) == 0

f1 = Foo( [1,2], ['a','b','c'] )
f2 = Foo( [1,2], ['a','b','c'] )
f3 = Foo( [1,2], ['a','b','d'] )
f1 == f2, f1 == f3
(True, False)
I'm not really sure if I'm implementing iter() correctly, for
instance: should I make copies of the sublists?  Should I try to
implement my own next() method?
Advice, comments, and links to good tutorial web pages on iterators
are appreciated!
Hi Marcus,
Here are some points I noticed -
1) I would probably change your __eq__ method to something like this:
def __eq__(self,other):
   return (self.head,self.tail) == (other.head,other.tail)
2) Or, if you really want your __eq__ method to use the iterator 
returned by __iter__(),

def __eq__(self, other):
for i, j in map(None,self, other):
if i != j:
return False
return True
One reason this might be a little better than your version is that using 
zip() as you have, f1 = Foo( [1,2], ['a','b','c']) and f2 = Foo( [1,2], 
['a','b','c','q'] ) would compare equal. Another reason is that this 
version returns False as soon as it figures out the lists are not equal.

3) It's not a big deal, but instead of what you have in __iter__(), I 
might import itertools and then write something like

def __iter__(self):
return itertools.chain(self.head,self.tail)
4) In this specific case, if you want to use the iterator returned by 
__iter__ in your __eq__ method, I think you should avoid using a next(). 
Here's a silly example why:

class Foo2(object):
   def __init__(self, listA,listB):
  self.head,self.tail = listA,listB
  self._current = -1
  self._cache = None
   def _fill_cache(self):
   """save some state"""
   if not self._cache:
   self._cache = self.head + self.tail
   def __iter__(self):
   """the iterator is the iterable object itself"""
   return self
   def next(self):
   """make the object an iterator"""
   self._fill_cache()
   self._current += 1
   if self._current >= len(self._cache):
   raise StopIteration
   return self._cache[self._current]
   def __eq__(self, other):
   for i, j in map(None,self, other):
   if i != j:
   return False
   return True
if __name__ == '__main__':
f1 = Foo2( [1,2], ['a','b','c'])
f2 = Foo2( [1,2], ['a','b','c'])
f3 = Foo2( [1,2], ['a','b','d'])
print f1 == f2, f1 == f3, f1 == f3 # notice the output here

Good luck.
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] odd behavior within __init__

[Rich Krauter]

Orri Ganel wrote:
Hello all,
As part of a project i'm doing (mostly for the fun of it), I have a
class which creates a sort of wrapper around any object to make it
suitable for use in a custom container.  However, if the class
receives an already wrapped object, I want it to just return the
object (same id and everything as the original). Now, the following
seems to work in the __init__ method (due to output), but then it
disappears as soon as the __init__ method is left:
class Node:
...
def __init__(self, cargo=None, prev=None, next=None, nod=False):
   """x.__init__(...) initializes x; see
x.__class__.__doc__ for signature"""
   if not isinstance(cargo, Node) or nod:
   self.cargo = cargo
   self.prev = prev
   self.next = next
   else:
   self = cargo
   print id(self), id(cargo)
   print self.cargo

a = Node(1)
b = Node(a)
12932600 12932600
1
id(b)
12960632
Any ideas on why this happens, or suggestions as to how to implement
the behavior I'm looking for (in which b and a would refer to the same
object, have the same id, etc.), would be greatly appreciated.
Thanks in advance,
Orri

Orri,
Maybe you could use a factory. It would allow you to simplify your Node 
class, and encapsulate the instantiation behavior you want outside the 
class.

class Node(object):
def __init__(self,cargo=None,prev=None,next=None):
self.cargo = cargo
self.prev = prev
self.next = next
def factory(cargo=None,prev=None,next=None):
if isinstance(cargo,Node):
return cargo
else:
return Node(cargo,prev,next)
n1 = factory(1)
print id(n1)
n2 = factory(n1)
print id(n2)
Good luck,
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] problems with doctest: apparent interferance between tests (LONG)

[Rich Krauter]

Brian van den Broek wrote:
[text and code snipped]
FWIW, I ran your code using python 2.3.4 on linux with the following 
modifications, and it worked fine (no failing tests out of 9):

1- added 'from sets import Set as set' since set() isn't built in in 2.3
2- changed True back to False in the following test:
'''Creates a new _Check_point instance; appends it to .data.
>>> # print "Testing check_point (intentional fail)."
>>> print Wall_clock.is_instanced
True

3- omitted the optionflags=doctest.ELLIPSIS argument from the following 
code, since it's not available in python 2.3's doctest:

def _test():
import doctest, sys
doctest.testmod(sys.modules[__name__], report = True,
   optionflags = doctest.ELLIPSIS)
Running the same code with 2.4 gave 3 failures out of 9 tests.
Rich

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] dictionary dispatch for object instance attributes question

[Rich Krauter]

Brian van den Broek wrote:
[snip text]

class A:
def __init__(self):
self.something = None
self.something_else = None
self.still_another_thing = None

def update(self, data):

for key in metadata_dict:
if data.startswith(key):
exec('''self.%s = """%s"""''' %(metadata_dict[key],
 data[len(key):]))
# triple quotes as there may be quotes in metadata
# values
break
[snip usage example and additional text]
Brian,
You could use setattr(self,metadata_dict[key],data[len(key):]).
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] regex problem

[Rich Krauter]

Michael Powe wrote:
Hello,
I'm having erratic results with a regex.  I'm hoping someone can
pinpoint the problem.
This function removes HTML formatting codes from a text email that is
poorly exported -- it is supposed to be a text version of an HTML
mailing, but it's basically just a text version of the HTML page.  I'm
not after anything elaborate, but it has gotten to be a bit of an
itch.  ;-)
def parseFile(inFile) :
import re
bSpace = re.compile("^ ")
multiSpace = re.compile(r"\s\s+")
nbsp = re.compile(r" ")
HTMLRegEx =
re.compile(r"(<|<)/?((!--.*--)|(STYLE.*STYLE)|(P|BR|b|STRONG))/?(>|>)
",re.I)
f = open(inFile,"r")
lines = f.readlines()
newLines = []
for line in lines :
line = HTMLRegEx.sub(' ',line)
line = bSpace.sub('',line)
line = nbsp.sub(' ',line)
line = multiSpace.sub(' ',line)
newLines.append(line)
f.close()
return newLines
Now, the main issue I'm looking at is with the multiSpace regex.  When
applied, this removes some blank lines but not others.  I don't want
it to remove any blank lines, just contiguous multiple spaces in a
line.

Hi Michael,
If you use '\s\s+', and a line has ' \n' (space then newline) at the 
end, the space and the newline will match and be substituted. If the 
line ends in 'some chars\n' or the line is just '\n', the newline will 
stay.

An alternate approach might be to first get rid of any leading or 
trailing whitespace (including \r|\n), then get rid of 'internal' 
repeated space, with string methods.

Parsing html using regexes is likely to break easily; HTMLParser is a 
better solution, but may it may seem more complicated at first. It may 
be worthwhile for you to look into that module; someone here would be 
able to help if necessary.

Short of the HTMLParser approach, I would try to reduce the dependence 
on regexes, using string methods where you can.

I would try something like this (untested) in your for loop to start:
for line in lines:
line = line.strip()
line = line.replace(' ',' ')
line = HTMLRegEx.sub(' ',line)
line = ' '.join(line.split())
newLines.append(line)
The only pattern left is HTMLRegEx. Using HTMLParser you could probably 
remove regexes completely. When I used perl for most things, I don't 
think I wrote a single script that didn't use regexes. Now, I use python 
for most things, and I don't think I have a single python module that 
imports re. Weird.

BTB, this also illustrates a difference between python and perl -- in
perl, i can change "line" and it automatically changes the entry in
the array; this doesn't work in python.  A bit annoying, actually.
;-)
I once had the same trouble with python - some features annoyed me 
because they weren't like perl. Now I have the reverse problem, only 
this time my annoyance is justified. :)

Thanks for any help.  If there's a better way to do this, I'm open to
suggestions on that regard, too.
Good luck.
Rich


___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] CGI help

[Rich Krauter]

David Holland wrote:
Rich,
That worked although I had to set the address to :-
http://127.0.0.1:8000/friends1.html
Thanks.
Good catch, sorry about that. I noticed you had spaces in the "how many" 
field in your form. Did your cgi still work? If not, I guess you figured 
that out by now too.

Interestingly, I had trouble getting the server/cgi to work with python 
2.4/Windows XP.

If I started the server with python 2.4 and put 2.4 in the cgi's #! 
line, the cgi didn't work.

If I used 2.3 to start the server, and put 2.3 or 2.4 in the cgi's #! 
line, the cgi worked.

I tried the same combinations on linux, and they all worked fine.
Anyone else seen this problem with python 2.4 on windows xp? I looked 
quickly at diffs of the relevant codes between 2.3 and 2.4, and I did a 
quick bug search on sourceforge, but didn't turn up anything yet.

Of course it may not be a bug; it may be a problem with my setup. The 
files I used are posted below, in case anyone wants to try to reproduce 
the result I saw.

Thanks.
Rich

<>
import CGIHTTPServer
import BaseHTTPServer
def run(server_class=BaseHTTPServer.HTTPServer,
handler_class=CGIHTTPServer.CGIHTTPRequestHandler):
server_address = ('', 8000)
httpd = server_class(server_address, handler_class)
httpd.serve_forever()
run()
<>
<>
#!C:/Python24/python.exe
print "Content-Type: text/html"
print
import cgi,cgitb
cgitb.enable()
reshtml = '''


CGI Demo


Friends list for:%s
Your name is: %s
You have %s friends.

'''
form = cgi.FieldStorage()
who = form.getfirst('person')
howmany = form.getfirst('howmany')
print reshtml % (who, who, howmany)
<>

<>



CGI Demo



Friends list for New User

Enter your name
How many friends do you have?
0
10
25
50
100>




<>

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] CGI help

[Rich Krauter]

David Holland wrote:
I have written my first cgi script :-
The .html code is :-

Friends CGI Demo (Static Screen)

Friends list for:New User

Enter your name>

How many friends do you have ?
0
10
25
50
100

The python code is :-
#!/usr/bin/env python
import cgi
reshtml = '''Content-Type: text/html\n

Friends CGI Demo (dynamic screen)

Friends list for: %s
Your name is: %s
You have %s friends.
'''
form = cgi.FieldStorage()
who = form['person'].value
howmany = form['howmany'].value
print reshtml % (who, who, howmany)
Now when I open the page using konqueror and click on
submit. Instead of the code running, it justs opens
the .py program in a different window.
Any ideas ? 



Hi David,
You can use a small python script to provide a cgi web server for testing:

import BaseHTTPServer
import CGIHTTPServer
def run(server_class=BaseHTTPServer.HTTPServer,
handler_class=CGIHTTPServer.CGIHTTPRequestHandler):
server_address = ('', 8000)
httpd = server_class(server_address, handler_class)
httpd.serve_forever()
run()

Put this in a file called, say, server.py. In the same directory as 
server.py, put a directory called cgi-bin. Put your python cgi scripts 
in cgi-bin. Modify the action tag in your html form to point to 
/cgi-bin/friends1.py. Click on the server.py icon, or run it from the 
command line.

Finally, point your browser to http://127.0.0.1:8000/cgi-bin/friends1.py.
You'll proably want to use apache or some other server if you want to do 
more than just test or demo cgi scripts locally, but this can be a 
useful alternative for testing simple cgi programs without installing 
additional software on your machine.

Good luck.
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Basic question -> How to use a class from a file?

[Rich Krauter]

Bernard Lebel wrote:
Okay here comes the next question.
In that class, I have 3 functions. Actually, one of them calls the two 
others.

However when I call these functions (wich are placed before the caller 
in the file), I get an error saying that the global name x (the function 
name) is not defined.

What am I doing wrong?


Hi Bernard,
This is just a guess since you didn't post your code, but did you call 
the 'bare' methods in your class definition, rather than calling the 
methods through an instance (which is usually called 'self' inside class 
definitions)?

I think the following may be similar to what you wanted to do:
class A(object):
def __init__(self,data=None):
self.data = data
def methodA(self):
self.methodB()
self.methodC()
def methodB(self):
print "in methodB"
print self.data
def methodC(self):
print "in methodC"
print self.data
if __name__ == '__main__':
a1 = A(5)
a1.methodA()
a2 = A([1,2,3])
a2.methodA()
Hope this helps.
Rich
___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

RE: [Tutor] How to substitute an element of a list as a pattern for re.compile()

[Rich Krauter]

kumar s wrote:
I have Question: 
How can I substitute an object as a pattern in making
a pattern. 

x = 30
pattern = re.compile(x)


Kumar,
You can use string interpolation to insert x into a string, which can 
then be compiled into a pattern:

x = 30
pat = re.compile('%s'%x)
I really doubt regular expressions will speed up your current searching 
algorithm. You probably need to reconsider the data structures you are 
using to represent your data.


I have a list of numbers that I have to match in
another list and write them to a new file:
List 1: range_cors 
range_cors[1:5]
['161:378', '334:3', '334:4', '65:436']
List 2: seq
seq[0:2]
['>probe:HG-U133A_2:1007_s_at:416:177;
Interrogation_Position=3330; Antisense;',
'CACCCAGCTGGTCCTGTGGATGGGA']


Can you re-process your second list? One option might be to store that 
list instead as a dict, where the keys are what you want to search by 
(maybe a string like '12:34' or a tuple like (12,34)).

Maybe something like the following:
>>> range_cors = ['12:34','34:56']
>>> seq = {'12:34': ['some 12:34 data'],
...'34:56': ['some 34:56'data','more 34:56 data']}
>>> for item in range_cors:
... print seq[item]
... 
['some 12:34 data']
['some 34:56 data','more 34:56 data']
Why is this better?
If you have m lines of data and n patterns to search for, then using 
either of your methods you perform n searches per line,  totalling 
approx. m*n operations. You have to complete approx. m*n operations 
whether you use the string searching version, or re searching version.

If you pre-process the data so that it can be stored in and retrieved 
from a dict, pre-processing to get your data into that dict costs you 
roughly m operations, but your n pattern lookups into that dict cost you 
only n operations, so you only have to complete approx. m+n operations.


A slow method:
sequences = []
for elem1 in range_cors:
for index,elem2 in enumerate(seq):
if elem1 in elem2:
sequences.append(elem2)
sequences.append(seq[index+1])
A faster method (probably):
for i in range(len(range_cors)):
for index,m in enumerate(seq):
pat = re.compile(i)
if re.search(pat,seq[m]):
p.append(seq[m])
p.append(seq[index+1])

I am getting errors, because I am trying to create an
element as a pattern in re.compile(). 

pat = re.compile('%s'%i) would probably get rid of the error message, 
but that's probably still not what you want.

Questions:
1. Is it possible to do this. If so, how can I do this.  
You can try, but I doubt regular expressions will help; that approach 
will probably be even slower.

Can any one help correcting my piece of code and
suggesting where I went wrong. 
I would scrap what you have and try using a better data structure. I 
don't know enough about your data to make more specific processing 
recommendations; but you can probably avoid those nested loops with some 
careful data pre-processing.

You'll likely get better suggestions if you post a more representative 
sample of your data, and explain exactly what you want as output.

Good luck.
Rich

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] sorting and editing large data files

[Rich Krauter]

Scott Melnyk wrote:
Hello!
I recently suffered a loss of programming files (and I had been
putting off my backups...)
[snip]
#regular expression to pull out gene, transcript and exon ids
info=re.compile('^(ENSG\d+\.\d).+(ENST\d+\.\d).+(ENSE\d+\.\d)+')
#above is match gene, transcript, then one or more exons
#TFILE = open(sys.argv[1], 'r' )#read the various 
transcripts from
WFILE=open(sys.argv[1], 'w')# file to write 2 careful 
with 'w'
will overwrite old info in file
W2FILE=open(sys.argv[2], 'w')   #this file will have the 
names of
redundant exons
import sets
def getintersections(fname='Z:\datasets\h35GroupedDec15b.txt'):
exonSets = {}
f = open(fname)
for line in f:
if line.startswith('ENS'):
parts = line.split()
gene = parts[0]
transcript = parts[1]
exons = parts[2:]
exonSets.setdefault(gene,
 sets.Set(exons)).intersection(sets.Set(exons))
^^
	return exonSets

Hi Scott,
There may be other problems, but here's one thing I noticed:
exonSets.setdefault(gene,
sets.Set(exons)).intersection(sets.Set(exons))
should be
exonSets.setdefault(gene,
   sets.Set(exons)).intersection_update(sets.Set(exons))
Hope that helps.
Rich

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor