[Tutor] Using python's smtp server
I have an app that generates a file one a day and would like to email it using python's SMTP server. http://docs.python.org/2/library/smtpd.html#smtpd.SMTPServer The documentation is kinda sparse and I cant seem to find any good examples. Basically what I want to do; when my app runs it would initiate a SMTP server, send the attachment and shutdown the SMTP after. Vincent Davis 720-301-3003 ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Using python's smtp server
Mark, Thanks mark, It had been about 15hr since I posted to python-list@python.organd had not seen a response so I thought I would try tutor.python.org. Well I got a response now, not that it helped, but I respond on that list. Thanks again. Vincent Davis 720-301-3003 On Fri, Dec 13, 2013 at 10:07 AM, Mark Lawrence breamore...@yahoo.co.ukwrote: On 13/12/2013 16:48, Vincent Davis wrote: I have an app that generates a file one a day and would like to email it using python's SMTP server. http://docs.python.org/2/library/smtpd.html#smtpd.SMTPServer The documentation is kinda sparse and I cant seem to find any good examples. Basically what I want to do; when my app runs it would initiate a SMTP server, send the attachment and shutdown the SMTP after. Vincent Davis 720-301-3003 Please refer to the answer you've already received on the main Python mailing list. -- My fellow Pythonistas, ask not what our language can do for you, ask what you can do for our language. Mark Lawrence ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] parse text file
On Thu, Jun 3, 2010 at 1:02 PM, Colin Talbert talbe...@usgs.gov wrote: Dave, I think you are probably right about using decompressor. I couldn't find any example of it in use and wasn't having any luck getting it to work based on the documentation. Maybe I should try harder on this front. Is it possible write a python script to transfer this to a hdf5 file? Would this help? Thanks Vincent Colin Talbert GIS Specialist US Geological Survey - Fort Collins Science Center 2150 Centre Ave. Bldg. C Fort Collins, CO 80526 (970) 226-9425 talbe...@usgs.gov From: Dave Angel da...@ieee.org To: Colin Talbert talbe...@usgs.gov Cc: Steven D'Aprano st...@pearwood.info, tutor@python.org Date: 06/03/2010 12:36 PM Subject: Re: [Tutor] parse text file -- Colin Talbert wrote: snip You are so correct. I'd been trying numerous things to read in this file and had deleted the code that I meant to put here and so wrote this from memory incorrectly. The code that I wrote should have been: import bz2 input_file = bz2.BZ2File(r'C:\temp\planet-latest.osm.bz2','rb') str=input_file.read() len(str) Which indeed does return only 90. Which is also the number returned when you sum the length of all the lines returned in a for line in file with: import bz2 input_file = bz2.BZ2File(r'C:\temp\planet-latest.osm.bz2','rb') lengthz = 0 for uline in input_file: lengthz = lengthz + len(uline) print lengthz snip Seems to me for such a large file you'd have to use bz2.BZ2Decompressor. I have no experience with it, but its purpose is for sequential decompression -- decompression where not all the data is simultaneously available in memory. DaveA ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] (no subject)
probably need to do something like python C:\py3eg\quadratic.py your cmd prompt/shell should know python is a command On Tue, May 11, 2010 at 2:43 AM, Sivapathasuntha Aruliah sivapathasuntha.arul...@amkor.com wrote: Hi I am learning Python. When I tried to run any of the program for example csv2html1_ans.py it displays the following message. This error is coming on both Python24 Python 31. That is whether i give the any one of the following command *COMMAND GIVEN* 1.C:\python24\python.exe C:\py3eg\quadratic.py 2.C:\python31\python.exe C:\py3eg\quadratic.py A message below appears with the program name. Please advice me how to get over from this issue *ERROR MESSAGE* command C:\py3eg\csv2html1_ans.py is not a valid Win32 application Regards, Siva Test Equipment Engineering Amkor Technology (S) Pte Ltd 1 Kaki Bukit View #03-28 TechView Building Singapore 415941 Tel: (65) 6347 1131 Fax: (65) 6746 4815 ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Newbie Unittest ...
I can't think of a way to do what you ask, without defining a test for each.
ButI think what you might actually want is the define the error message to
report which one failed. ie, it's one test with a meaningful error message.
'Failed to load' + str(file)+' '+ str(k)+', '+str(v)
I am not ecpert on unittests
*Vincent Davis
720-301-3003 *
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedInhttp://www.linkedin.com/in/vincentdavis
On Wed, May 5, 2010 at 6:37 PM, Damon Timm damont...@gmail.com wrote:
Hi - am trying to write some unit tests for my little python project -
I had been hard coding them when necessary here or there but I figured
it was time to try and learn how to do it properly.
I've read over Python's guide
(http://docs.python.org/library/unittest.html) but I am having a hard
time understanding how I can apply it *properly* to my first test case
...
What I am trying to do is straightforward, I am just not sure how to
populate the tests easily. Here is what I want to accomplish:
# code
import unittest
from mlc.filetypes import * # the module I am testing
# here are the *correct* key, value pairs I am testing against
TAG_VALUES = (
('title', 'Christmas Waltz'),
('artist', 'Damon Timm'),
('album', 'Homemade'),
)
# list of different file types that I want to test my tag grabbing
capabilities
# the tags inside these files are set to match my TAG_VALUES
# I want to make sure my code is extracting them correctly
FILES = (
FLACFile('data/lossless/01 - Christmas Waltz.flac'),
MP3File('data/lossy/04 - Christmas Waltz (MP3-79).mp3'),
OGGFile('data/lossy/01 - Christmas Waltz (OGG-77).ogg'),
MP4File('data/lossy/06 - Christmas Waltz (M4A-64).m4a'),
)
class TestFiles(unittest.TestCase):
# this is the basic test
def test_values(self):
'''see if values from my object match what they should match'''
for file in FILES:
for k, v in TAG_VALUES:
self.assertEqual(self.file.tags[k], v)
This test works, however, it only runs as *one* test (which either
fails or passes) and I want it to run as 12 different tests (three for
each file type) and be able to see which key is failing for which file
type. I know I could write them all out individually but that seems
unnecessary.
I suspect my answer lies in the Suites but I can't wrap my head around it.
Thanks!
Damon
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Newbie Unittest ...
By they way you shouldn't need to use str(file) as I did. Unlessit is
not a string already. Bad habit. I am used to numbers
vincet
On Thursday, May 6, 2010, Vincent Davis vinc...@vincentdavis.net wrote:
I can't think of a way to do what you ask, without defining a test for each.
ButI think what you might actually want is the define the error message to
report which one failed. ie, it's one test with a meaningful error message.
'Failed to load' + str(file)+' '+ str(k)+', '+str(v)I am not ecpert on
unittests
Vincent Davis
720-301-3003
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedIn http://www.linkedin.com/in/vincentdavis
On Wed, May 5, 2010 at 6:37 PM, Damon Timm damont...@gmail.com wrote:
Hi - am trying to write some unit tests for my little python project -
I had been hard coding them when necessary here or there but I figured
it was time to try and learn how to do it properly.
I've read over Python's guide
(http://docs.python.org/library/unittest.html) but I am having a hard
time understanding how I can apply it *properly* to my first test case
...
What I am trying to do is straightforward, I am just not sure how to
populate the tests easily. Here is what I want to accomplish:
# code
import unittest
from mlc.filetypes import * # the module I am testing
# here are the *correct* key, value pairs I am testing against
TAG_VALUES = (
('title', 'Christmas Waltz'),
('artist', 'Damon Timm'),
('album', 'Homemade'),
)
# list of different file types that I want to test my tag grabbing
capabilities
# the tags inside these files are set to match my TAG_VALUES
# I want to make sure my code is extracting them correctly
FILES = (
FLACFile('data/lossless/01 - Christmas Waltz.flac'),
MP3File('data/lossy/04 - Christmas Waltz (MP3-79).mp3'),
OGGFile('data/lossy/01 - Christmas Waltz (OGG-77).ogg'),
MP4File('data/lossy/06 - Christmas Waltz (M4A-64).m4a'),
)
class TestFiles(unittest.TestCase):
# this is the basic test
def test_values(self):
'''see if values from my object match what they should match'''
for file in FILES:
for k, v in TAG_VALUES:
self.assertEqual(self.file.tags[k], v)
This test works, however, it only runs as *one* test (which either
fails or passes) and I want it to run as 12 different tests (three for
each file type) and be able to see which key is failing for which file
type. I know I could write them all out individually but that seems
unnecessary.
I suspect my answer lies in the Suites but I can't wrap my head around it.
Thanks!
Damon
___
Tutor maillist - tu...@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Newbie Unittest ...
On Thu, May 6, 2010 at 1:15 PM, Steve Willoughby st...@alchemy.com wrote: The unit test methods all take message arguments so if you just want to customize the reported error, that's easily done. something like: self.assertEqual(self.file.tags[k], v, Failure with key +k) That's easiest. If you really want a separate test for each, you may want to create a factory function which will generate the individual test methods when the testcase object is created. --steve Looks like Steve answered the question you had for me, self.assertEqual(self.file.tags[k], v, Failure with key +k) I think this is the best(how I would do it) solution, 1 test for files with a meaningful report as to which file is the problem. *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis On Thu, May 6, 2010 at 1:15 PM, Steve Willoughby st...@alchemy.com wrote: The unit test methods all take message arguments so if you just want to customize the reported error, that's easily done. something like: self.assertEqual(self.file.tags[k], v, Failure with key +k) That's easiest. If you really want a separate test for each, you may want to create a factory function which will generate the individual test methods when the testcase object is created. --steve ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] New class, how return value of x in interactive shell
I am working an a open source project and would like to add feature to a
class.
Current action:
in:b = BString.new('I am a BString object')
out: b
in:BString - Python:0x1044846c8 / R:0x105c86f50
in:print(b)
out: 21-letter BString instance
seq: I am a BString object
What I would like is to be able to
in b
out 21-letter BString instance
seq: I am a BString object
I have 2 questions
1, how do I do this?
2, how does print know what to do?
I have a lot to learn so pointing me in the right direction or to
documentation is as useful as the correct code.
Thanks
*Vincent Davis
720-301-3003 *
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedInhttp://www.linkedin.com/in/vincentdavis
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] New class, how return value of x in interactive shell
Take a look at the repr and str methods: http://docs.python.org/reference/datamodel.html#basic-customization Ok so I am still a little confused, It seems that __str__ is used for print and str() byt what allows whats below. That is why does just entering the name of the instance return print(b). I have tried a few combinations but not the right one. in b out 21-letter BString instance seq: I am a BString object *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis On Mon, Apr 5, 2010 at 11:24 AM, Wayne Werner waynejwer...@gmail.comwrote: ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] New class, how return value of x in interactive shell
That' a very strange idiom in Python.
Can you show us the class definition?
It's a bioconductor extension to rpy2
http://www.bitbucket.org/lgautier/rpy2-bioc-extensions/overview/
I am trying to learn R and at they same time more about python and R
bioconductor packages. So no it is not homework but I am trying to learn
something. I am sure the answer is obvious when you know it :)
Here is the class, although it is obviously part of something bigger, you
can checkout the full code at bitbuckit.org
class BString(XString):
Biological string
_bstring_constructor = biostrings.BString
@classmethod
def new(cls, x):
:param x: a (biological) string
res = cls(cls._bstring_constructor(conversion.py2ri(x)))
_setExtractDelegators(res)
return res
*Vincent Davis
720-301-3003 *
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedInhttp://www.linkedin.com/in/vincentdavis
On Mon, Apr 5, 2010 at 1:08 PM, Alan Gauld alan.ga...@btinternet.comwrote:
Vincent Davis vinc...@vincentdavis.net wrote
I am working an a open source project and would like to add feature to a
class.
Current action:
in:b = BString.new('I am a BString object')
That' a very strange idiom in Python.
Can you show us the class definition?
out: b
in:BString - Python:0x1044846c8 / R:0x105c86f50
in:print(b)
out: 21-letter BString instance
seq: I am a BString object
What I would like is to be able to
in b
out 21-letter BString instance
seq: I am a BString object
I have 2 questions
1, how do I do this?
2, how does print know what to do?
If you look at your class definition that should become obvious.
Are you sure this isn't a homework?
--
Alan Gauld
Author of the Learn to Program web site
http://www.alan-g.me.uk/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Difflib comparing string sequnces
@Ricardo Aráoz Thanks for your response, Before I saw your response I had posted the question on stack overflow. See link below. I like your solution better than the re solution posted. It looks like this task may take longer than I think. The .re solution I guess might take more than 10 days. The search string in 80million digits long. But Obviously I can stop once I find a match and then just move on the the next sequence. You might what to post this answer on stackoverflow. I like the more interactive form of a mailing list but there seems to be a very p\broad audience on stackoverflow. Thanks again, http://stackoverflow.com/questions/2420412/search-for-string-allowing-for-one-mismatches-in-any-location-of-the-string-pyth *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis 2010/3/10 Ricardo Aráoz ricar...@gmail.com Vincent Davis wrote: I have never used the difflib or similar and have a few questions. I am working with DNA sequences of length 25. I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma parasite) I am not sure how large the genome is but more that 230,000 sequences. The are programs that do this and really fast, and they eve do partial matches but not quite what I need. So I am looking to build a custom solution. I need to look for each of my sequences of 25 characters example( AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuos string (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAG.) I don't care where or how many times on if it exists. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as only wrong at 1 location and I what to record the location. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie 25 time. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 also : sequence = 'AGGCTTGCGGAGCCTGAGGGCGGAG' seqList = ['*' + sequence[0:i] + '?' + sequence[i+1:] + '*' for i in range(len(sequence))] import fnmatch genome = 'CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAG' if any(fnmatch.fnmatch(genome, i) for i in seqList) print 'It matches' Which might be better if the sequence is fixed and the genome changes inside a loop. HTH ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] Difflib comparing string sequnces
I have never used the difflib or similar and have a few questions. I am working with DNA sequences of length 25. I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma parasite) I am not sure how large the genome is but more that 230,000 sequences. The are programs that do this and really fast, and they eve do partial matches but not quite what I need. So I am looking to build a custom solution. I need to look for each of my sequences of 25 characters example( AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuos string (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAG.) I don't care where or how many times on if it exists. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as only wrong at 1 location and I what to record the location. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie 25 time. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 *Vincent Davis 720-301-3003 * vinc...@vincentdavis.net my blog http://vincentdavis.net | LinkedInhttp://www.linkedin.com/in/vincentdavis ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] list to numpy record array
@Kent
All I know about RecordArrays is from reading this page:
http://www.scipy.org/RecordArrays
but it looks like you have done the right thing and created a
RecordArray. What is wrong with this result?
The number are completely different, or I have no idea how to read it.
Here are the first row of each
normal array [' 0', ' 0', '234.0', '24.0', ' 25']
Record array [(3153952, 0, 0.0, 0.0, 0)
*Vincent Davis
720-301-3003 *
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedInhttp://www.linkedin.com/in/vincentdavis
On Tue, Feb 23, 2010 at 6:30 AM, Kent Johnson ken...@tds.net wrote:
On Mon, Feb 22, 2010 at 11:50 PM, Vincent Davis
vinc...@vincentdavis.net wrote:
I must be missing something simple. I have a list of lists data = [['
0', ' 0', '234.0', '24.0', ' 25'], [' 1', ' 0', '22428.0', '2378.1', '
25'],.. and what to make a record array from it but it gets screwed up
or I don't get it, maybe both.
bdata = numpy.array(data, [('x', int),('y',
int),('mean',float),('stdv',float),('npixcels',int)])
bdata
array([[(3153952, 0, 0.0, 0.0, 0), (3153952, 0, 0.0, 0.0, 0),
...
(3486240, 0, 0.0, 0.0, 0)]],
dtype=[('x', 'i8'), ('y', 'i8'), ('mean', 'f8'), ('stdv',
'f8'), ('npixcels', 'i8')])
All I know about RecordArrays is from reading this page:
http://www.scipy.org/RecordArrays
but it looks like you have done the right thing and created a
RecordArray. What is wrong with this result?
Kent
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] list to numpy record array
I must be missing something simple. I have a list of lists data = [[' 0',
' 0', '234.0', '24.0', ' 25'], [' 1', ' 0', '22428.0', '2378.1', '
25'],.. and what to make a record array from it but it gets screwed up
or I don't get it, maybe both. Notice that at this stage the items are
strings, not numbers, and there is whitespace not sure this matters.
Here is what is happening
adata = numpy.array(data,numpy.float64)
adata
array([[ 0.e+00, 0.e+00, 2.3400e+02,
2.4000e+01, 2.5000e+01],
...,
[ 4.7700e+02, 4.7700e+02, 2.0700e+02,
4.5800e+01, 2.5000e+01]])
This is what I would expect except it is not a record array.
This is not what I expect. I think I have tried every iteration including
using numpy dtaypes numpy.int32 or bdata = numpy.array(data, dtype = [('x',
int),('y', int),('mean',float),('stdv',float),('npixcels',int)])
What am I missing?
bdata = numpy.array(data, [('x', int),('y',
int),('mean',float),('stdv',float),('npixcels',int)])
bdata
array([[(3153952, 0, 0.0, 0.0, 0), (3153952, 0, 0.0, 0.0, 0),
(206933603122, 0, 0.0, 0.0, 0), (808334386, 0, 0.0, 0.0, 0),
(3486240, 0, 0.0, 0.0, 0)],
[(3219488, 0, 0.0, 0.0, 0), (3153952, 0, 0.0, 0.0, 0),
(1356161439282, 0, 0.0, 0.0, 0),
(54074581398322, 0, 0.0, 0.0, 0), (3486240, 0, 0.0, 0.0, 0)],
[(3285024, 0, 0.0, 0.0, 0), (3153952, 0, 0.0, 0.0, 0),
(206933931058, 0, 0.0, 0.0, 0), (925775666, 0, 0.0, 0.0, 0),
(3486240, 0, 0.0, 0.0, 0)],
...,
[(3487540, 0, 0.0, 0.0, 0), (3618612, 0, 0.0, 0.0, 0),
(206933602866, 0, 0.0, 0.0, 0), (908996661, 0, 0.0, 0.0, 0),
(3486240, 0, 0.0, 0.0, 0)],
[(3553076, 0, 0.0, 0.0, 0), (3618612, 0, 0.0, 0.0, 0),
(13561596370041137, 0, 0.0, 0.0, 0),
(62870573495603, 0, 0.0, 0.0, 0), (3486240, 0, 0.0, 0.0, 0)],
[(3618612, 0, 0.0, 0.0, 0), (3618612, 0, 0.0, 0.0, 0),
(206933798962, 0, 0.0, 0.0, 0), (942552372, 0, 0.0, 0.0, 0),
(3486240, 0, 0.0, 0.0, 0)]],
dtype=[('x', 'i8'), ('y', 'i8'), ('mean', 'f8'), ('stdv', 'f8'),
('npixcels', 'i8')])
*Vincent Davis
720-301-3003 *
vinc...@vincentdavis.net
my blog http://vincentdavis.net |
LinkedInhttp://www.linkedin.com/in/vincentdavis
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Structure of my simulation / monte-carlo
Kent Johsnon writes This class has a lot of responsibilities: - create applicants - create institutions - run a single match - run multiple matches - calculate statistics on the result of multiple matches A principle of object-oriented design is that a class should have a single responsibility. I would break your class up a bit using multiple classes, perhaps. I am trying to do what you recomend, as much as makes sense to me, but that is why I ask the question so I should consider your answer. This is what I hear you saying, (I don't mean to represent them as sub-classes but more how they would operate on each other) Should I consider making Institutions) a subclass of (Make Institutions)? I can't think of anything that would make sense to inherit. class Simulation: class Create Institutions: class Institutions: class create Applicants: class Applicants: class Match: class Multi Match: I add I am thinking class Simulation: def__init__:(self, results, stats.repeat..) def create_applicants(): class Applicants def creat_institutions(): class Institutions def one_simulation(): # one or more create_applicants() create_institutions() class Match() class Results def repeat_simulation() repeat one_simulations class Results After writing this out I now think you are right, more classes. Which means I really need to play with function objects to understand how they are passed down the layers Simulation(GPA = random.gauss(50, 10), repeat = 100.) MakeApplicants(GPA) Applicants(GPA) # I need to make sure the GPA is calculated at each applicant not back at Simulation. DaveA ask if it will always be random.gauss? No, I would like it to be anything from a constant to a much more complex function) DaveA I would caution you that each instance of RepeatMatch will then hold lots of the other members, so keeping them around could be expensive This means they stay in memory? Is there a way to know how much room a instance takes up, in memory or hard drive? I could serialize them a save them to a sqlite when done with a simulation correct? How is a questions for later. worried that you might find my responses too complex I am kinda working in a vacuum, with respect to python programing. Complex and difficult are ok, The challenge is not knowing what I don't know. I need to practice with function objects and run a few experiments still to make sureI understand them. DaveA and Kent Thanks for all your help, Vincent To add a little more to what I am doing I am using CherryPy to host this simulation. So the GPA function and other simulation variables can be entered in a html form and passed to the Simulation class. Then I am calculating results as well as using matplotlib to make some plots, these results and plots then get show. I think I have most of the CherryPy stuff figured out once I have the Simulations class setup to do the whole thing. The only part with CherryPy I am still working on is displaying progress on the browser as the simulations runs, it can take several minutes. Thanks Vincent Davis 720-301-3003 On Sun, Nov 1, 2009 at 6:02 AM, Dave Angel da...@ieee.org wrote: Vincent Davis wrote: I ask this question in part because of a fee remarks from another question I ask class attribute to initiate more classes Basically I am simulation the process of applicants to schools and trying to ask/answer some questions like what conditions do you need to have an optimal solution Oh and to learn python. I basically had it working as a script rather than using a class structure but it was very inflexible and I still needed to learn about classes. What I have these classes class Applicant: has lots of attributes (self.gpa = random.gauss(50, 10) about the Applicant and def() defining how/why an applicant applies to an institution, class Institution: Lots of attributes (self.quality = random.gauss(50, 10)) about the Institution and def() defining how the institution considers the applicant. class Match: this defines the interaction of the population of Applicants and Institutions, i.e. the rules of the game and returns the outcome i.e. which Applicants went to which Institutions. As of now I have been running 1 Match at a time. Which is to say generate 8000 instances of Applicant and 300 instances of Institution and then run the match Match(app_list, inst_list) and I do this with a short script. So now I need to implement my monte-carlo. By that I mean that i want to set some of the initial condition such as GPA, and Quality and basically re-run the what I descried above, (generate applicant, institutions, match them) Then save the results. So my plan way to make a new class. This class would define the Applicant characteristics self.gpa = random.gauss(mean, SD) and the institutions self.quality = random.gauss(mean, sd) so it would look
Re: [Tutor] Structure of my simulation / monte-carlo
Just to be clear,or try, given a set of applicants and institutions the Match will always have the same result. So when I am repeating the Match this only makes sense to do is I am also making new applicants and institutions. So I am sampling Match results drawn from a process that is initiated with a distributions set at the applicant and institution level. Thanks Vincent Davis On Sun, Nov 1, 2009 at 9:58 AM, Kent Johnson ken...@tds.net wrote: On Sun, Nov 1, 2009 at 10:47 AM, Vincent Davis vinc...@vincentdavis.net wrote: Kent Johsnon writes This class has a lot of responsibilities: - create applicants - create institutions - run a single match - run multiple matches - calculate statistics on the result of multiple matches A principle of object-oriented design is that a class should have a single responsibility. I would break your class up a bit using multiple classes, perhaps. I am trying to do what you recomend, as much as makes sense to me, but that is why I ask the question so I should consider your answer. This is what I hear you saying, (I don't mean to represent them as sub-classes but more how they would operate on each other) Should I consider making Institutions) a subclass of (Make Institutions)? I can't think of anything that would make sense to inherit. class Simulation: class Create Institutions: class Institutions: class create Applicants: class Applicants: class Match: class Multi Match: I add I am thinking class Simulation: def__init__:(self, results, stats.repeat..) def create_applicants(): class Applicants def creat_institutions(): class Institutions def one_simulation(): # one or more create_applicants() create_institutions() class Match() class Results def repeat_simulation() repeat one_simulations class Results After writing this out I now think you are right, more classes. Now you are getting too complicated. You don't need to use inheritance or nested classes, and you can use simple methods (not classes) to create applicants and institutions. You already have Applicant, Institution and Match classes that run a single match. Now make a RepeatMatch class that uses the Match class to run multiple simulations. Kent ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Structure of my simulation / monte-carlo
Thanks again for all your help Kent and Dave. I think you won't here from me for a week or more as I digest your advise and work on my project. Thanks Vincent Davis 720-301-3003 On Sun, Nov 1, 2009 at 6:34 PM, Dave Angel da...@ieee.org wrote: Kent Johnson wrote: On Sun, Nov 1, 2009 at 10:47 AM, Vincent Davis vinc...@vincentdavis.net wrote: Kent Johsnon writes This class has a lot of responsibilities: - create applicants - create institutions - run a single match - run multiple matches - calculate statistics on the result of multiple matches A principle of object-oriented design is that a class should have a single responsibility. I would break your class up a bit using multiple classes, perhaps. I am trying to do what you recomend, as much as makes sense to me, but that is why I ask the question so I should consider your answer. This is what I hear you saying, (I don't mean to represent them as sub-classes but more how they would operate on each other) Should I consider making Institutions) a subclass of (Make Institutions)? I can't think of anything that would make sense to inherit. class Simulation: class Create Institutions: class Institutions: class create Applicants: class Applicants: class Match: class Multi Match: I add I am thinking class Simulation: def__init__:(self, results, stats.repeat..) def create_applicants(): class Applicants def creat_institutions(): class Institutions def one_simulation(): # one or more create_applicants() create_institutions() class Match() class Results def repeat_simulation() repeat one_simulations class Results After writing this out I now think you are right, more classes. Now you are getting too complicated. You don't need to use inheritance or nested classes, and you can use simple methods (not classes) to create applicants and institutions. You already have Applicant, Institution and Match classes that run a single match. Now make a RepeatMatch class that uses the Match class to run multiple simulations. Kent I mostly agree with Kent, but I apparently disagree about which classes are actually needed. Think what things will have actual instances that will last long enough to be worth formally defining. So you need Applicant, and Institution, and Simulation. Notice they're all singular. I'm assuming one simulation is a single set of test data, with its results. Then you create as many instances of Simulation as you need for comparison purposes, and perhaps keep a list of them. It's not clear that list needs any further structure than the built-in list type provides. You don't need a class for creating an Applicant, that's just a line or two in a loop in the Simulation class. Similarly for Institution. And if I understand it correctly, you don't need very many different methods in Simulation either. You need the __init__ to save enough information to tag this particular simulation (call it a label, it's probably just a string). If __init__ is too complex, you may want to break it into several phases. But they'll always be called in direct succession, so there may not be any point. Then you need something that triggers an analysis, and something that queries for particular results. That last will then be called from plotting or charting routines. But you probably don't need anything special for a collection of Simulation objects. A list will probably be fine. And from what you said earlier, you WILL need function objects, probably as parameters to the Simulation constructor. So each instance of Simulation will be given several function objects to specify the distribution functions for the parameters to be used when creating Applicants and Institutions. DaveA ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] class attribute to initiate more classes
DaveA posted
import random, functools
class Person:
def __init__(self, size):
self.size = size
def __str__(self):
return Person of size %s % self.size
class MakePeople:
def __init__(self, random_func):
self.random_func = random_func
def make_them(self, count):
return [Person(self.random_func()) for i in xrange(count)]
people_maker = MakePeople(functools.partial(random.gauss, 100, 2))
persons = people_maker.make_them(100)
for person in persons:
print person.size
I changed the last line, from
print person
print person.size
So this does what I want, but I am not sure why.
I read the entry about functools.partial but it was not very clear to me.
If I
people_maker = MakePeople(random.gauss(100, 2))
then I only get 1 random #.
and if I
MakePeople('random.gauss(100, 2)')
then I just a fix string
So DaveA uses
functools.partial(random.gauss, 100, 2)
not obvious to me from that it should not be
functools.partial(random.gauss(100, 2))
and I guess the other key is
Person(self.random_func())
Also now this
people_maker = MakePeople(123)
does not work, which is not terrible.
Anyone have some more to add, I would not have confidence in applying this
to new situations and it seems.
Also I thank DaveA improving my Python conventions. I am really bad about
that. Is there a cheat sheet for Python conventions.
Like class (Capitals), def (two_words), I guess I should make my own.
Thanks
Vincent Davis
720-301-3003
On Sat, Oct 31, 2009 at 5:55 AM, Dave Angel da...@ieee.org wrote:
Vincent Davis wrote:
I have a program that generates many instances of a class with an
attribute
self.x = random.gauss(10, 2). So each instance has a different value for
self.x. This is what I want. Now I want to make a class that starts my
program and sets the attributes.
class people:
def __init__(self, size)
self.size = size
class makepeople:
def __init__(self, randomsize)
self.rsize = randomsize
self.allpeople = []
def makethem():
for x in range(1,100):
p+str(x) = people(self.rsize)
allpeople.append(p+str(x))
so what I would like to have work is set the attribute of makepeople so
that
when it is used to make instances of people each will have a different
size.
listofp = makepeople(random.guass(100, 2))
listofp.makethem()
I would then what listofp.allpeople to be a list of people with different
sizes. The above code does not work, I don't think it does anyway.
I hope this makes sense, I am sure there is a term for what I am trying to
do but I don't know it.
Thanks
Vincent Davis
You're trying to do several things here, and I'm unclear on many of the
details. So here's a new spec, and the implementation for it.
We want a factory class, which can be given a particular distribution
function and parameters, and using those parameters generate a list of
Person objects, whose heights are distributed according to that random
function. There might be duplicates in that list, but they'd be random
coincidence, and the list as a whole would be as random as the function
specified by the caller.
I also took a few liberties on the names of things, trying to use Python
conventions for naming, and things like using a singular word for a
classname of a single item. And I removed the allpeople attribute, as the
class only makes sense to me if you can use its instance multiple times, to
generate more items with the same given distribution.
CODE
import random, functools
class Person:
def __init__(self, size):
self.size = size
def __str__(self):
return Person of size %s % self.size
class MakePeople:
def __init__(self, random_func):
self.random_func = random_func
def make_them(self, count):
return [Person(self.random_func()) for i in xrange(count)]
people_maker = MakePeople(functools.partial(random.gauss, 100, 2))
persons = people_maker.make_them(100)
for person in persons:
print person
/CODE---
DaveA
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] class attribute to initiate more classes
Vincent Davis wrote:
DaveA posted
import random, functools
class Person:
def __init__(self, size):
self.size = size
def __str__(self):
return Person of size %s % self.size
class MakePeople:
def __init__(self, random_func):
self.random_func = random_func
def make_them(self, count):
return [Person(self.random_func()) for i in xrange(count)]
people_maker = MakePeople(functools.partial(random.gauss, 100, 2))
persons = people_maker.make_them(100)
for person in persons:
print person.size
I changed the last line, from
print person
print person.size
So this does what I want, but I am not sure why.
I read the entry about functools.partial but it was not very clear to me.
If I
people_maker = MakePeople(random.gauss(100, 2))
then I only get 1 random #.
and if I
MakePeople('random.gauss(100, 2)')
then I just a fix string
So DaveA uses
functools.partial(random.gauss, 100, 2)
not obvious to me from that it should not be
functools.partial(random.gauss(100, 2))
and I guess the other key is
Person(self.random_func())
Also now this
people_maker = MakePeople(123)
does not work, which is not terrible.
Anyone have some more to add, I would not have confidence in applying this
to new situations and it seems.
Also I thank DaveA improving my Python conventions. I am really bad about
that. Is there a cheat sheet for Python conventions.
Like class (Capitals), def (two_words), I guess I should make my own.
Thanks
Vincent Davis
720-301-3003
snip
For the official Python style guide, see
http://www.python.org/dev/peps/pep-0008/
There are a couple of things going on in my code sample, and I'll try to
elaborate on them. I'm not claiming it's the 'right' answer, just that it
satisfies what I think were the most important goals you had. But if you
want to save the list in the MakePeople() instance, you'd add an additional
parameter to its constructor, and combine the second method into __init__().
But as someone else points out, at that point, it's then hardly worth
making a class out of it.
First the tough part. In your original code, your caller was doing:
listofp = makepeople(random.guass(100, 2))
But that passes only a single value into the makepeople constructor. If
you're always going to use gaussian, then you can just move the function
call into the make_them() loop. But if you want to do the same thing, but
with a different distribution, you need to pass a function object instead.
Learning about function objects is very useful. You should really play
with them in a simpler situation, to get an idea how they work.
At its simplest, a function object is just the function name, without
parentheses. You can store it (and pass it as a parameter to another
function) just like any other object. And then when you actually want to
call it, you can use the new name with parentheses, kind of like an alias to
the original function name.
import math
def indirection(funcobject, argument):
return funcobject(math.pi/180 * argument)
print indirection(math.sin, 30)
print indirection(math.cos, 30)
Now what happens here? The indirection() function calls an entirely
different function the two times it's called, one time it calls sin, and the
other time it calls cos. As long as all the arguments to the function are
going to be supplied here, there's no confusion. Try the same thing with
any other set of functions, given that all of them take the same number and
types of arguments.
This opens the door to all sorts of things, such as a mini-calculator
(following is mostly pseudo-code):
funcname = getnamefrom user()
angleinradians = getnumberfromuser()
converter_dict = { sin: math.sin, cos:math.cos }
print converter_dict[funcname](angleinradians)
So the values of the dictionary are actual function objects, ready to be
called.
What happens if some of the function parameters are known to the caller,
and not to the callee? I'll use the random.gauss example again. If we want
the caller to be able to specify them, we could do something like the
following:
def print_indirection(funcobject, arg1, arg2, count):
for i in xrange(count):
print funcobject(arg1, arg2)
and call it:
print_indirection(random.gauss, 100, 2, 44)
to get 44 values with a gaussian distributon. But now suppose we wanted to
be able to use the same function with random.getrandbits() ? That function
only takes a single parameter, so the print funcobject() would blow up.
functools.partial lets us bind a function object with some or all of its
arguments already attached. So in our case, the caller (who knows what the
arguments look like) gets to lay them out, without being stuck with any
particular ones.
So, we rewrite print_indirection something like this:
def print_indirection(funcobject, count):
for i in xrange(count):
print funcobject()
and call
[Tutor] Structure of my simulation / monte-carlo
I ask this question in part because of a fee remarks from another question I ask class attribute to initiate more classes Basically I am simulation the process of applicants to schools and trying to ask/answer some questions like what conditions do you need to have an optimal solution Oh and to learn python. I basically had it working as a script rather than using a class structure but it was very inflexible and I still needed to learn about classes. What I have these classes class Applicant: has lots of attributes (self.gpa = random.gauss(50, 10) about the Applicant and def() defining how/why an applicant applies to an institution, class Institution: Lots of attributes (self.quality = random.gauss(50, 10)) about the Institution and def() defining how the institution considers the applicant. class Match: this defines the interaction of the population of Applicants and Institutions, i.e. the rules of the game and returns the outcome i.e. which Applicants went to which Institutions. As of now I have been running 1 Match at a time. Which is to say generate 8000 instances of Applicant and 300 instances of Institution and then run the match Match(app_list, inst_list) and I do this with a short script. So now I need to implement my monte-carlo. By that I mean that i want to set some of the initial condition such as GPA, and Quality and basically re-run the what I descried above, (generate applicant, institutions, match them) Then save the results. So my plan way to make a new class. This class would define the Applicant characteristics self.gpa = random.gauss(mean, SD) and the institutions self.quality = random.gauss(mean, sd) so it would look something like this class RepeatMatch: def __int__(self, app_mean, app_sd, inst_mean, inst_sd, match_ repeat) self.app_mean = app_mean …….. self.match_repeat = match_repeat def makeApplicants(): def makeInstitutions(): def runMatches(self) # runs the match match_repeat number of times, saves results # then I calculate some characteristics of the results def ratio_dist(): # returns the Mean and sd of GPA/Quality END OF CODE Does it make sense to do it this way? Is there a better/alternative way of thinking about this. In the end I want to compare the results of repeated simulations RepeatMatch(50,2….) Compared to RepeatMatch(50,15….) This is way I had ask the earlier question class attribute to initiate more classes Thanks Vincent Davis ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] class attribute to initiate more classes
I have a program that generates many instances of a class with an attribute self.x = random.gauss(10, 2). So each instance has a different value for self.x. This is what I want. Now I want to make a class that starts my program and sets the attributes. class people: def __init__(self, size) self.size = size class makepeople: def __init__(self, randomsize) self.rsize = randomsize self.allpeople = [] def makethem(): for x in range(1,100): p+str(x) = people(self.rsize) allpeople.append(p+str(x)) so what I would like to have work is set the attribute of makepeople so that when it is used to make instances of people each will have a different size. listofp = makepeople(random.guass(100, 2)) listofp.makethem() I would then what listofp.allpeople to be a list of people with different sizes. The above code does not work, I don't think it does anyway. I hope this makes sense, I am sure there is a term for what I am trying to do but I don't know it. Thanks Vincent Davis ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] calculating a sort key and operator.attrgetter()
Thanks for the help, Looks like I will define a function. And yes you are
right self.does_observe is constant so it will not affect the outcome.
Thanks again
Vincent Davis
On Tue, Jun 30, 2009 at 11:15 PM, Kent Johnson ken...@tds.net wrote:
On Tue, Jun 30, 2009 at 11:39 PM, Vincent Davisvinc...@vincentdavis.net
wrote:
I have a class with an attribute which is a list rank_list this is a
list
of instances f another class that has attributes quality, is_observed
if I want to sort the list by the attribute quality I can just use,
self.rank_list.sort(key=operator.attrgetter('quality'))
But I want to sort like this.
self.rank_list.sort(key=(operator.attrgetter('quality') *
operator.attrgetter('is_observed') * self.does_observe))
Will this work or is there a better way?
That won't work because attrgetter() returns a function and you can't
multiply functions. What you can do is define your own function that
returns the value you want for the key and use that for the sort. I'm
leaving out self.does_observe because that won't change for the list
items, wil it?
def make_key(item):
return item.quality * item.is_observed
self.rank_list.sort(key=make_key)
Kent
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
[Tutor] calculating a sort key and operator.attrgetter()
I have a class with an attribute which is a list rank_list this is a list
of instances f another class that has attributes quality, is_observed
if I want to sort the list by the attribute quality I can just use,
self.rank_list.sort(key=operator.attrgetter('quality'))
But I want to sort like this.
self.rank_list.sort(key=(operator.attrgetter('quality') *
operator.attrgetter('is_observed') * self.does_observe))
Will this work or is there a better way?
Thanks
Vincent Davis
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] list of instance objects, access attribute
Thanks to all for the comments, It was much more than I expected. Vincent On Fri, Jun 19, 2009 at 4:30 PM, Lie Ryanlie.1...@gmail.com wrote: Alan Gauld wrote: Vincent Davis vinc...@vincentdavis.net wrote class B(): def __init__(self, b1, b2): self.fooa = b1 self.foob = b2 I assume thats what you really meant! Ok now I have several instances in a list b1 = B(1, 2) b2 = B(3, 4) b3 = B(9, 10) alist = [b1, b2, b3] Lets say for each instance of the class I want to print the value of fooa if it is greater than 5. How do I do this, define a method of the class, say bigprint() def bigprint(self, limit=5): if self.fooa limit: print self.fooa about is how I iterate over the values of fooa. Iterate over the objects and call the method. Make the object do the work, your code should not need to know about the internal attributes of the object. For x in alist: x.bigprint() Is that the right way or is there a better? will this work for methods? Methods are how you should do it. Direct access other than for simple reading of values is a suspicious design smell. Any processing of or rules about the data should be in a method. Personally, I often thought input/output inside an object is a design smell (except for debugging), preferring something like this: class B(object): def __init__(...): ... def big(self, limit=5): return (self.fooa limit) alist = [...] for y in (x for x in alist if x.big()): print y.fooa although admittably often it could make certain codes more difficult to write; and in some cases the practical approach would be warranted. This is especially true as the codebase gets larger. ___ Tutor maillist - tu...@python.org http://mail.python.org/mailman/listinfo/tutor ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] list of instance objects, access attribute
given a class like class B(): def __init__(self, b1, b2): self.fooa = fooa self.foob = foob Ok now I have several instances in a list b1 = B(1, 2) b2 = B(3, 4) b3 = B(9, 10) alist = [b1, b2, b3] Lets say for each instance of the class I want to print the value of fooa if it is greater than 5. How do I do this, what I am unclear about is how I iterate over the values of fooa. As I write this I am thinking of trying For x in alist: if x.fooa 5 : print(x.fooa) Is that the right way or is there a better? will this work for methods? Thanks Vincent Davis ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] 3.0 on Mac
Here is what my .bash_profile looks like, This is in my user directory
# Setting PATH for EPD_Py25 v4.3.0
# The orginal version is saved in .bash_profile.pysave
PATH=/Library/Frameworks/Python.framework/Versions/Current/bin:${PATH}
export PATH
PYTHONPATH=/Volumes/iDisk/match/python
export PYTHONPATH
Note that the file /Library/Frameworks/Python.framework/Versions/Current
is a symbolic link to the actual python. You could change the smbolic link
or pint the Bash_profile directly to the python you want. I also found it
difficult to understand the PYTHONPATH, As yu see it above Python will look
in my idisk for modules to import. So if I have a file names mymod.py
in /Volumes/iDisk/match/python and I import mymod it will find it.
Hope this helps, When I was learning abut python I found it difficult to
find spisific instructins for this. Part of the problem Is that it seems
that most instruction assume some understanding of terminal than I had. I
know little more that what allows me to follow clear instructions.
Thanks
Vincent Davis
720-301-3003
On Thu, Jun 11, 2009 at 9:54 PM, Dave Angel da...@ieee.org wrote:
acfleck wrote:
I'm a Python nubie and having trouble with 3.0.1 on Mac (10.4.11). I did a
default install of MacPython 3.0.1. The IDLE.app works fine, but from a
Terminal window, the 'python' command still gets me V2.5.3 (the original
Apple installed version). A 'python3' command is not recognized. I'd like to
know what I need to change to access V3.0.1 from a Terminal window.
Use the 'which' command to see what versions of python are on your PATH.
Then, since you have two different versions of Python you want available,
create one or more scripts (on your path), to explicitly run the other
installed versions. Probably, those scripts can be one line each, though
you also might conceivably want to set an environment variable or two (such
as pythonpath)
As far as I know, the install will not create a script called python3, or
anything else like it. That's up to you. And it's generally not good form
to hide the system-installed version, since many utilities and scripts might
depend on that particular version.
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] question about class
Thanks for the help and comments, I think my questions have been answered, I will know if I understand when I try to implement them. The Match algorithm. algorithm is described in the link below. The Applicant and School rankings will be (Attributes ?) of the Applicant and School class, and I simulate this ranking process by considering Applicants and Schools attributes, but basically similar qualities get mutually ranked. (I go go on if someone is interested but I thought it best to keep the discution on what I am trying to learn about classes) http://www.nrmp.org/res_match/about_res/algorithms.html Thanks Again Vincent Davis On Tue, Jun 9, 2009 at 1:12 AM, spirdenis.s...@free.fr wrote: Le Mon, 8 Jun 2009 17:31:23 -0600, Vincent Davis vinc...@vincentdavis.net s'exprima ainsi: Accidentally sent I have added the rest (by the way I refrain from using the terms attribute, method, as I will likely miss use them) I am reading several tutorials about classes and trying to figure out how to apply it to my project. I have a working program that basically matches up applicants and schools. Schools and applicants have and true quality and an observed quality. Then there is an algorithm that matches them up. Right now I do this all with lists which works ok but I would like to try using classes. Questions 1, does it make seens to have a applicant and a schools class (based on this brief explanation) Based on your explanations, I don't really understand the problem you're trying to solve, nore the algorithm. Still, probably it makes sense to use Applicant and School classes for the simple reason these notions in your program represent objects: there are single, identified, things ; as opposed to values (in the ordinary sense of the term) that represent qualities or information such as color, position, number, or true and observed above. (By the way, don't use 'true', it's too misleading. Maybe 'truth' instead.) This notion of object identity would allow you, for instance, to match an applicant to a school by letting the applicant's attribute 'matched_school' directly point to a school itself, instead of a number that indirectly represents the school. Also, you've got a collection of schools and applicants, which probably means they will be stored in a set or a list. Once you have a type for them, it's easier to safely manipulate them in a unified manner. Even if they have only one single data attribute, I would do it: this also brings a centralised place to expose the object type's structure and behaviour. 2, is it possible to have a class for the algorithm that will modify values in the applicant and schools class for example applicant.matched = 4 and school.matched = 343 meaning applicant 343 is matched to school 4 No, if I understand what you mean. You won't have a separate class only to store actions (python is not java), but instead you should precisely attribute these as methods to the Applicant or School types. 3, is I have a value set in a class applicant.foo = 5 and I what to use a (method?) in the class to change this, what is the right way to do this? Below an example: class Point(object): def __init__(self, x=0,y=0): self.x = x self.y = y def move(self, dx,dy): print self, self.x += dx self.y += dy print -- %s % self def __str__(self): return Point (%s,%s) % (self.x,self.y) p0 = Point() ; print p0 p = Point(9,8) ; print p p.move(-11,11) == Point (0,0) Point (9,8) Point (9,8) -- Point (-2,19) Denis -- la vita e estrany ___ Tutor maillist - tu...@python.org http://mail.python.org/mailman/listinfo/tutor ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] question about class
Thanks again for the help, A little followup. For my applicant class I have a few initial values that need to be set but I what to choose the value (actually the calculation to set the value) for each applicant (instance?) Here is the start of my Applicant Class class Applicant(object): quality is refers to the quality of the Applicant observe refers to the accuracy of which they assess the quality of the school def __init__(self, quality = 0, observe = 0): self. quality = quality self. observe = observe def Quality(self, mean, sd): print self, self.quality = normalvariate(mean, sd) print -- %s % self def Observe(self, mean, sd): print self, self. observe = normalvariate(mean, sd) print -- %s % self Or I could I guess do it this way, Is this better? I will only be setting the quality and observe values once for each instance. class Applicant(object): quality is refers to the quality of the Applicant observe refers to the accuracy of which they assess the quality of the school def __init__(self, mquality = 0, sdquality = 0, mobserve = 0, sdobserve = 0): self. quality = normalvariate(mquality, sdquality) self. observe = normalvariate(mobserve, sdobserve) Thanks Vincent Davis 720-301-3003 On Tue, Jun 9, 2009 at 7:02 AM, Vincent Davisvinc...@vincentdavis.net wrote: Thanks for the help and comments, I think my questions have been answered, I will know if I understand when I try to implement them. The Match algorithm. algorithm is described in the link below. The Applicant and School rankings will be (Attributes ?) of the Applicant and School class, and I simulate this ranking process by considering Applicants and Schools attributes, but basically similar qualities get mutually ranked. (I go go on if someone is interested but I thought it best to keep the discution on what I am trying to learn about classes) http://www.nrmp.org/res_match/about_res/algorithms.html Thanks Again Vincent Davis On Tue, Jun 9, 2009 at 1:12 AM, spirdenis.s...@free.fr wrote: Le Mon, 8 Jun 2009 17:31:23 -0600, Vincent Davis vinc...@vincentdavis.net s'exprima ainsi: Accidentally sent I have added the rest (by the way I refrain from using the terms attribute, method, as I will likely miss use them) I am reading several tutorials about classes and trying to figure out how to apply it to my project. I have a working program that basically matches up applicants and schools. Schools and applicants have and true quality and an observed quality. Then there is an algorithm that matches them up. Right now I do this all with lists which works ok but I would like to try using classes. Questions 1, does it make seens to have a applicant and a schools class (based on this brief explanation) Based on your explanations, I don't really understand the problem you're trying to solve, nore the algorithm. Still, probably it makes sense to use Applicant and School classes for the simple reason these notions in your program represent objects: there are single, identified, things ; as opposed to values (in the ordinary sense of the term) that represent qualities or information such as color, position, number, or true and observed above. (By the way, don't use 'true', it's too misleading. Maybe 'truth' instead.) This notion of object identity would allow you, for instance, to match an applicant to a school by letting the applicant's attribute 'matched_school' directly point to a school itself, instead of a number that indirectly represents the school. Also, you've got a collection of schools and applicants, which probably means they will be stored in a set or a list. Once you have a type for them, it's easier to safely manipulate them in a unified manner. Even if they have only one single data attribute, I would do it: this also brings a centralised place to expose the object type's structure and behaviour. 2, is it possible to have a class for the algorithm that will modify values in the applicant and schools class for example applicant.matched = 4 and school.matched = 343 meaning applicant 343 is matched to school 4 No, if I understand what you mean. You won't have a separate class only to store actions (python is not java), but instead you should precisely attribute these as methods to the Applicant or School types. 3, is I have a value set in a class applicant.foo = 5 and I what to use a (method?) in the class to change this, what is the right way to do this? Below an example: class Point(object): def __init__(self, x=0,y=0): self.x = x self.y = y def move(self, dx,dy): print self, self.x += dx self.y += dy print -- %s % self
[Tutor] question about class
I am reading several tutorials about classes and trying to figure out how to apply it to my project. I have a working program that basically matches up applicants and schools. Schools and applicants have and true quality and an observed quality. Then there is an algorithm that matches them up. Right now I do this all with lists which works ok but I would like to try using classes. Questions 1, does it make seens to have a applicant and a schools class (based on this brief explanation) 2, is it possible to have a class for the algorithim that will modify values in the applicant and schools class Thanks Vincent Davis 720-301-3003 ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] question about class
Accidentally sent I have added the rest (by the way I refrain from using the terms attribute, method, as I will likely miss use them) I am reading several tutorials about classes and trying to figure out how to apply it to my project. I have a working program that basically matches up applicants and schools. Schools and applicants have and true quality and an observed quality. Then there is an algorithm that matches them up. Right now I do this all with lists which works ok but I would like to try using classes. Questions 1, does it make seens to have a applicant and a schools class (based on this brief explanation) 2, is it possible to have a class for the algorithm that will modify values in the applicant and schools class for example applicant.matched = 4 and school.matched = 343 meaning applicant 343 is matched to school 4 3, is I have a value set in a class applicant.foo = 5 and I what to use a (method?) in the class to change this, what is the right way to do this? Ok that's all for now ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
