Hi,
I tried your code too, but no success. is it because of the editor
display. I am working on Mac will that make a difference. I cannot get
correct tabs working?
On 4/29/07, Bill Luebkert <[EMAIL PROTECTED]> wrote:
> amit hetawal wrote:
> > Hello All,
> > I really dont kn
Hello All,
I really dont know whats causing this problem. Its like i have the
input file which looks like:
:set list on in vi
TGCAGAAGAGAGTGAGCAC$
TGCAGAAGAGAGTGAGCAC $
TGCAGAAGAGAGTGAGCAC $
TGCAGAAGAGAGTGAGCAC $
TGCAGAAGAGAGTGAGCAC $
TGCAGAAGAGAGTGAGCAC $
CGCAGAAGAGAGTGAGCACA$
TTGCAGAAGAAAGAGAGC
yes it is a DNA sequence i need to find.
But still not getting how.. should i go about.
Can you advise something
Thanks
On 3/2/07, [EMAIL PROTECTED]
<[EMAIL PROTECTED]> wrote:
>
> If those letters were different, I'd think you were working on a chunk of
> DNA... P-))
>
> Deane Rothenmaier
>
hello,
Thanks for your previous reponses.
Now this time i am using the right syntax for matching, for the string like:
$temp= "AAABBBCCCBBBVBBB"
I need to write a regex for filterin out the string between.
AAA
BBB
CCC
so in the above case i should have the output as:
AAAZ
A
Sorry about that i got it.. It was a wrong way i was using the
=~ s. thing..
My bad
On 3/2/07, Kevin Roland Viel <[EMAIL PROTECTED]> wrote:
> On Fri, 2 Mar 2007, amit hetawal wrote:
>
> > Hello all,
> >
> > I have a string which comes from a d
hello,
I tried this also,
my actual string looks like:
$temp='196818OVA_Chlre2_kg.scaffold_4000234YEE1\'conservedmembraneproteinSequence
:196818OVA_Chlre2_kg.scaffold_4000234YEE1\'conservedmembraneprotein';
#$name = $1;
$temp = ~s/'//g;
print $temp;
its gives me: 429496729
Hello all,
I have a string which comes from a database entry which looks like:
$temp = "X''";
now i want to remove all the single qoutes from this string ( ' ) so
as to make it looks like:
"X"
I am trying to write a simple regex for it but its not working for me.
$temp
On 7/15/06, pDale <[EMAIL PROTECTED]> wrote:
> On 7/15/06, amit hetawal <[EMAIL PROTECTED]> wrote:
>
> > I am trying to divide a large file into small number of different
> > files and need to pass these smaller files as arugument to some other
> > perl scrip
Hello,
I am trying to divide a large file into small number of different
files and need to pass these smaller files as arugument to some other
perl script. Now my large file has the format as :
Input file
***
>testing1
hello ,
Thanks for the help .
But my problem is that i need to get 3 different hashes for all uni bi
tri grams ..
coz later in my code i have to calculate the value as
trigram{hello how are} /bigram{hello how}
so how do i relate the 2 values in the hashes ...
i used a code as :
my($prev1,$prev2
hello all,
I have a text file and i want to get the total number of occurences of
each unigrams that is one word , and the bigram the simultaneous
occurence of 2 words and same for 3 words as trigrams.
I want to store them in hash tables but am not able to get how to
parse through the text file and
hello,
Can somebody help me with this:I have a matix as below:
suggest transcription nuclear response
role sequence
Doc1 01 11
0 0
Doc2 10 0
Hi ,
Just need a bit help..
How do i every of the + sign from my document.
its like my documnet has the words in the format as:
G+Chdgf {every line has only word in it}
HC4+
+djd
hffd+hdd
how do i remove the + signs from these..?
Can you help me out
On 4/5/06, [EMAIL PROTEC
Hi ,
I was just tryin the document and word matrix...but i dont know its alwasy givin me an error as :
Quantifier follows nothing before HERE mark in regex m/+ << HERE /-/ at C:\perl\bin\test\NEW_TE~2.PL line 92, line 1.ations
And i am not getting why is it happenin.
when i try the same code o
Hello all,
here is the updated info about the problem:
I have the file as :
hello how r u hi all what r u doini am fine
Now what i have to do is to form a matrix as Hello fine D1 1 1 .D2 0 1 ; D3 0 0D4 1 1
Hello all,
I am struggling hard for doing thsi but still not able to get. Its like i have a xml file whose excerpt is given below as :
IL-2 gen _expression_ and NF-kappa B activation
through CD28 requires reactive oxygen production by 5-lipoxygenase .
...
...
do get them or use them.
Can you please help.
Thanks ,
Amit
On Wed, 08 Feb 2006 Brian Raven wrote :
>Steve Dawson <> wrote:
> > amit hetawal wrote:
> >
> >>
> >> ?
> >> Hello all,
> >> I am writing a matrix to a file as :
> >>
?
Hello all,
I am writing a matrix to a file as :
open(WRITE, ">training.txt");
for ($x = 1; $x<27; ++$x)
{
for($y=1; $y<27;++$y)
{
print WRITE "$matrix[$x][$y] ";
}
print WRITE "\n";
}
this code is working fine and writing the file in format as ;
0 0 0 0 0 0 0 1 1 1
2 3
18 matches
Mail list logo
