Hello,
If using vmatchPattern to find a sequence in another sequence, the resulting
end index can be beyond the length of the subject XStringSet. For example:
forwardPrimer <- "TCTTGTGGAAAGGACGAAACACCG"
> range(width(reads))
[1] 75 75
primerEnds <- vmatchPattern(forwardPrimer, reads, max.mismatc
Hi Dario,
On 11/16/2016 02:00 AM, Dario Strbenac wrote:
Good day,
I'd like to request that extractAllMatches works when subject is an XStringSet.
The function could check that subject and mindex have the same length and then
process them in parallel. Currently, the following example isn't imm
On 11/16/2016 12:43 PM, Gabriel Hoffman wrote:
I submitted a new version of my package variancePartition to the devel
branch on Monday. My new version is v1.5.1, but the latest build/check
was run on v1.5.0. I checked and my new version is in the svn and git
repos, so it seems like the daily bu
I submitted a new version of my package variancePartition to the devel
branch on Monday. My new version is v1.5.1, but the latest build/check
was run on v1.5.0. I checked and my new version is in the svn and git
repos, so it seems like the daily build/check didn't run.
Build report (v1.5.0):
Thank you for the detailed reply. I think I have managed to fix it now.
Syncing the Bioconductor-mirror properly was actually the only major thing
required. For my local Git repository, I cloned a fresh copy (including
pre-Bioconductor history) from GitHub, created a new master branch from the
pre
On 11/16/2016 04:56 AM, Lukas Weber wrote:
Hi,
Is there any way to reset the devel branch of a package SVN repo / git
mirror to an earlier state, or simply to delete the devel branch and start
again from a copy of release-3.4?
I made a mess in my SVN repo by trying to combine my previous git hi
On 11/16/2016 02:44 AM, Ted Wong wrote:
Hi,
I need help to reproduce a crash in my crash report.
The crash report is:
http://master.bioconductor.org/checkResults/3.4/bioc-LATEST/Anaquin/malbec1-buildsrc.html
This is what I did:
1. svn co --username ... --password
https://hedgehog.fhcrc
Good day,
I'd like to request that extractAllMatches works when subject is an XStringSet.
The function could check that subject and mindex have the same length and then
process them in parallel. Currently, the following example isn't immediately
possible.
words <- BStringSet(c("xxGOATzz", "xxM
Hi,
Is there any way to reset the devel branch of a package SVN repo / git
mirror to an earlier state, or simply to delete the devel branch and start
again from a copy of release-3.4?
I made a mess in my SVN repo by trying to combine my previous git history
(prior to Bioconductor acceptance) toge
On 11/15/2016 09:52 AM, Obenchain, Valerie wrote:
Hi Pariksheet,
On 11/15/2016 03:32 AM, Pariksheet Nanda wrote:
Hi folks,
It would be great to have an OrganismDb package for
Drosophila.melanogaster, similar to Homo.sapiens, Mus.musculus and
Rattus.norvegicus.
While trying to do this on my ow
On 11/15/2016 02:34 PM, Martin Morgan wrote:
On 11/15/2016 09:52 AM, Obenchain, Valerie wrote:
Hi Pariksheet,
On 11/15/2016 03:32 AM, Pariksheet Nanda wrote:
Hi folks,
It would be great to have an OrganismDb package for
Drosophila.melanogaster, similar to Homo.sapiens, Mus.musculus and
Rattus
Yes, I forked the Bioconductor git-mirror and then cloned my fork locally.
The local master branch automatically gets pushed to my forks master branch.
So now, I “solved it” for the devel branch by running:
git push –u origin devel
instead of just git push (and similar for the release branches).
12 matches
Mail list logo
