On 11/18/2016 02:00 AM, Dario Strbenac wrote:
Good day,
These questions really belong to the support site.
I suppose, although it seemed like an unexpected issue at first because it's
not documented within ?lowlevel-matching so users don't know what to expect.
You'll get that behaviour by
Good day,
> These questions really belong to the support site.
I suppose, although it seemed like an unexpected issue at first because it's
not documented within ?lowlevel-matching so users don't know what to expect.
> You'll get that behaviour by allowing indels.
This reveals a discrepancy
Hi,
These questions really belong to the support site.
On 11/16/2016 04:00 PM, Dario Strbenac wrote:
Hello,
If using vmatchPattern to find a sequence in another sequence, the resulting
end index can be beyond the length of the subject XStringSet. For example:
forwardPrimer <-
Hello,
If using vmatchPattern to find a sequence in another sequence, the resulting
end index can be beyond the length of the subject XStringSet. For example:
forwardPrimer <- "TCTTGTGGAAAGGACGAAACACCG"
> range(width(reads))
[1] 75 75
primerEnds <- vmatchPattern(forwardPrimer, reads,
