Hello,
Is there a way to assembly long 20kb mate pair libraries on Ray?
Both used the MiSeq 250x2 bp technology.
Cheers
Rick
--
Rapidly troubleshoot problems before they affect your business. Most IT
organizations don't
Hello,
It would be important to know one way or another.
Does it?
Cheers
Rick
--
Richard Allen White III M.S.
PhD Candidate - Suttle Lab
Department of Microbiology & Immunology
The University of British Columbia
Vancouver, BC, Canada
cell. 604-440-5150
http://www.ocgy.ubc.ca/~suttle/
I have some 200bp Ion Torrent Mate Pair data, Paired 250x2 MiSeq reads and
have merged the overlapping reads from the Illumina data.
When I try to run standard parameters in Ray the assemblies are worse with
the addition of the Ion Data.
Do you have parameters that could help me out?
Cheers
Rick
Hello Sebastien,
Could you suggest a way to do it?
Cheers
Rick
On Thu, Nov 21, 2013 at 1:20 PM, Sébastien Boisvert <
sebastien.boisver...@ulaval.ca> wrote:
> On 21/11/13 01:43 PM, Rick White wrote:
>
>> Hello,
>>
>> For MG-RAST upload it has two problems fro
Hello,
For MG-RAST upload it has two problems from Ray outputs.
The space between contig and number with unique sequence number for
example.
>contig-300 508 nucleotides
And, it needs coverage information for
>sequence_number_1_*[cov=2]*
CTAGCGCACATAGCATTCAGCGTAGCAGTCACTAGTACGTAGTACGTACC
>seq
--Note for ubuntu users--
If you install sudo apt-get install libcr-dev mpich2 mpich2-doccd
It will cause problems with you compile your Ray install with mpich2
--To avoid to this--
sudo apt-get install -y autotools-dev g++ build-essential
sudo apt-get remove libcr-dev mpich2 mpich2-doccd
sudo a
form up and running on the Ray Dev version same
problem.
Still confused on how to fix it.
Cheers and many thanks
Rick
On Fri, Jul 5, 2013 at 6:16 AM, Sébastien Boisvert <
sebastien.boisver...@ulaval.ca> wrote:
> On 04/07/13 04:29 PM, Rick White wrote:
>
>>
>>
&g
What is the command you are using to launch Ray?
>
> Pier-Luc
> Le 2013-07-04 18:51, Rick White a écrit :
>
> Hello again,
>
> I am confused on how to fix this problem in that it is not
> multi-threading any more?
>
> As I don't understand how it could stop all the
gt; git clone https://github.com/sebhtml/ray.git
>
> Pier-Luc
>
>
> Le 2013-07-04 18:26, Rick White a écrit :
>
> Hello Pier-luc,
>
>
> Normally, when I run the script I get more then one core running. But,
> currently only one core is running at a time cau
gt; to help you we need a little more information.
> Which version of Ray are you using?
> What are your system specs?
> What is the size of your sample?
>
> Pier-Luc
>
> Le 2013-07-04 17:36, Rick White a écrit :
>
> Hello again,
>
> Fun continues. The reinsta
Hello again,
Fun continues. The reinstall removed the libmpichcxx.so.1.2 error.
But, now it isn't running correctly and is running out of memory
error
Critical exception: The system is out of memory, returned NULL.
Requested -54534904 bytes of type RAY_MALLOC_TYPE_BLOOM_FILTER
HELP!
--
Richard
Hello Sebastien, (Ray users!)
I had ray working quite well on our server then all the sudden it stopped.
Worked fine yesterday.
I get this error
Ray: error while loading shared libraries: libmpichcxx.so.1.2: cannot open
shared object file: No such file or directory
I used sudo apt-get install in
On Fri, May 24, 2013 at 11:39 AM, Rick White wrote:
> It appeared the install went well but then I got this error on my ubuntu
> server.
>
> cannot connect to local mpd (/tmp/mpd2.console_labop); possible causes:
> 1. no mpd is running on this host
> 2. an mpd is runni
13 matches
Mail list logo
