Hi Clare,
As a technical add-on - you didn't mention what type OS you're looking to
install this on so I just wanted to mention that mi-deployment scripts are
tested primarily on Ubuntu 10.04 LTS and thus most likely to work properly
there. If you're also looking to setup the data, unfortunately
Colleagues,
We have set up a local Galaxy but I am having trouble running Cufflinks with
the annotation gtf file. We have the iGenomes btau4.2 genome in the database
and use the iGenomes btau4.2 gtf file in the history. However the –G isn’t
showing up in the command line (below) and the
Hi. I have an illumina 1.9 file that I renamed, groomed, and
interlaced to get to its current state (see first 2 sets of paired
sequences below)
@1
TTATCTGCATATACGAAATATACATTGAAAGTTGAAATAAATGATAAATTAAACCAATTA
+1
Hi,
I have Rad tag data that I'm trying to map to our reference genome in
Galaxy on our local instance. After barcode splitter, I have 96 files
(one each of all of the sequences for that individual). It seems like
the current tools (e.g. bowtie) can only map a single file to the
reference. I think
Hello all,
A one day Galaxy Developer
Workshophttp://evomics.org/workshops/galaxy-developer-workshop/has
been scheduled for 23 January in Český
Krumlov http://www.ckrumlov.info/php/, Czech Republic, immediately
following the Workshop on
