Hi all,
I'd like to suggest a tool, to see if it would be generally useful for
others, and if Mauve's authors would have the time to add it, and/or if
another easy solution exists.
It would be great if, when looking at a zoomed-in portion of aligned
genomes, I could hit a "screenshot" button that would give me the local
sub-sequences currently visible in the wondow. Something like:
>genomeA:100-120
TGTAGCAGACGAACTAGACAT
>genomeB:130-149
GTATCAGACGAACTAGACAT
>genomeC:700000-700020
TGTAGCAGACCAACTAGACAT
Does that make sense? It would output a multi-fasta file of the
currently-viewable sequence, with genome names and ranges (or chromosome
names and ranges? or both?). I'd find this very useful for a current
project, but I'm wondering if others would find it useful enough to clamor
for an added feature!
Thanks,
~Joe
--
Joseph Fass
Lead Data Analyst
UC Davis Bioinformatics Core
http://bioinformatics.ucdavis.edu/
joseph.fass -at- gmail.com
530.752.2698 (w)
------------------------------------------------------------------------------
Live Security Virtual Conference
Exclusive live event will cover all the ways today's security and
threat landscape has changed and how IT managers can respond. Discussions
will include endpoint security, mobile security and the latest in malware
threats. http://www.accelacomm.com/jaw/sfrnl04242012/114/50122263/
_______________________________________________
Mauve-users mailing list
Mauve-users@lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/mauve-users
