Re: s:g/T/U/ doesn't work ?

2012-10-24 Thread Marc Chantreux
hello again, i felt dumb reading your answers! it seems obvious now. thanks everyone. regards

Re: the nature of a scalar?

2012-10-24 Thread Moritz Lenz
On 10/24/2012 02:46 PM, Marc Chantreux wrote: use v6; use lib 'lib'; use Bailador; get / (.*) '/' / => sub ($path) { $path||="foo"; $path is a subroutine parameter, and thus read-only by default. If you want to modify $path locally, write sub ($path is copy) { ... } Also if Bailador

Re: s:g/T/U/ doesn't work ?

2012-10-24 Thread Jonathan Scott Duff
I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify constan

Re: s:g/T/U/ doesn't work ?

2012-10-24 Thread jerry gay
On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux wrote: > Cannot assign to a non-container > in sub infix:<=> at src/gen/CORE.setting:11692 > in block at /tmp/ZZZ:4 > you're attempting to modify a string constant, which cannot be modified. try something like (untested): my $snippet

Re: s:g/T/U/ doesn't work ?

2012-10-24 Thread Carl Mäsak
Marc (>): > hello perl6 people, > > On > > This is perl6 version 2012.09.1 > built on parrot 4.6.0 revision 0 > > When i try to run > > use v6; > use Test; > for 'GATGGAACTTGACTACGTAAATT' { > s:g/T/U/; > is $_ > , 'GAUGGAACUUGACUACGUAAAUU' > , 'RN

the nature of a scalar?

2012-10-24 Thread Marc Chantreux
hello perl6 people, this code says "foo", exactly as expected. use v6; my $path = ""; $path ||="foo"; say $path; I'm trying to use the same thinh in a get callback of Baildador and it doesn't work. i try to understand why is it so. use v6; use lib 'lib'; use Bailador; get / (

s:g/T/U/ doesn't work ?

2012-10-24 Thread Marc Chantreux
hello perl6 people, On This is perl6 version 2012.09.1 built on parrot 4.6.0 revision 0 When i try to run use v6; use Test; for 'GATGGAACTTGACTACGTAAATT' { s:g/T/U/; is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA'; } I get Cannot assign to