If you don't specify the :out adverb, then the output of the program you
are running will be sent to standard output. Immediately when the program
executes. If you specify the :out adverb, output from the program will be
available for capture via the $proc.out method. A similar thing applies
for
On Tue, May 1, 2018 at 8:37 AM, ToddAndMargo wrote:
> Hi All,
>
> I am trying to change the last three letters of a string
>
> $ perl6 -e 'my $x="abcabcabc"; $x ~~ s/"a.*"$/xyz/; say $x;'
>
The double quotes around your text make it a string literal, so it will
only match the literal string "a.*
Looking at that page myself, it doesn't appear that you can specify the
separator for .words. So ... no.
Though, that would make an interesting addition IMHO
-Scott
On Sat, Apr 14, 2018 at 12:27 AM, ToddAndMargo
wrote:
> Hi All,
>
> I am over on
> https://docs.perl6.org/routine/words
> an
If, by "regular book", you mean "bound paper sheafs with ink on them", then
the answer is currently "no". Is there something wrong with the
documentation online? (besides there not being enough of it :)
-Scott
On Mon, Jan 4, 2016 at 9:55 PM, Yonghua Peng wrote:
> Hello,
>
> Is there a regular
The block does get the topic, but the regex isn't executing immediately.
Another way to get what you want, rather than mentioning the topic
explicitly, is to use the m// form of match.
> grep { m/\.pl6/ },
(a.pl6)
For sanity's sake, I would recommend writing your match-immediately regex
like th
If you're not married to the "key : value" format, you could use this:
scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { .say for sort %d
}'
Here's another variation, but keeping your original format:
scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { say "$_.key() :
$_.value()"
I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify constan
On Thu, Apr 21, 2011 at 6:33 PM, gvim wrote:
> This is not a criticism of anything. I am not a core developer but need to
> be aware of what to expect when Perl 6 settles down into a production-ready
> state. The Perl 6 binary within the January release of Rakudo Star is 10Mb
> on my Snow Leopard
and codenames for 2009 is
available in the "docs/release_guide.pod" file. In general, Rakudo
development releases are scheduled to occur two days after each
Parrot monthly release. Parrot releases the third Tuesday of each month.
Have fun!
-Scott
--
Jonathan Scott Duff
perlpi...@gmail.com
gs
better. Et cetera.
Does she also have some problem with perl5? It sounds like she's
just trying to apply the "perl is line noise" argument but only for
perl6. IMHO, the same counter arguments apply.
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
t has an indirect dependency on
> Devel::Caller which fails to work using that compiler combination (i.e.,
> fails all tests after a build using its makefile and Visual Studio 2003 as
> the C compiler).
Bummer. You could check out the Vanilla/Strawberry Perl effort at
http://win32.p
ument type
appears in the "does list" of the Signature, then it's a match and all
is well. Otherwise it's an error. Since "Num does Int", a call such
as C succeeds.
At least that's my vague interpretation of this aspect of perl6 at
this moment. :-)
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
On Fri, Jun 23, 2006 at 06:55:28PM +0300, Markus Laire wrote:
> On 6/23/06, Jonathan Scott Duff <[EMAIL PROTECTED]> wrote:
> >An alternate interpretation would be that the last one is actually a
> >compile-
> >time error because none of the sigs match (Int,Int) and f
x27;d need to be explicit:
talk(~123,3);
But I'm not sure which way perl6 actually leans.
Though it seems to me that automatic type conversion by the compiler is
a way to get yourself in trouble. Not that perl shouldn't let the
programmer get himself in trouble, but this seems like one of those
things that should require asking to turn on rather than asking to
turn off.
my two cents,
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
t). If you're going to type @results, maybe it needs to be:
my @results is Array of Array of int;
or maybe
my Array of int @results;
Or something like that :-)
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
he way to go.
Binaries are definitely worth it to give people something to play with
(especially on difficult platforms like Windows). It doesn't have to be
the latest and greatest, it just has to implement a large-enough
feature set.
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
16 matches
Mail list logo
