[EMAIL PROTECTED] wrote:
>
>>I'm writing your name down and this is the last time I'm doing homework
>>for you.
>>
>>James
>>
>>
>
>
> Wow, you are really a pretentious asshole. If you don't want to provide
> people with help, don't bother.
>
> And that code's incorrect anyway.
>
So a smiley
>
> I'm writing your name down and this is the last time I'm doing homework
> for you.
>
> James
>
>
Wow, you are really a pretentious asshole. If you don't want to provide
people with help, don't bother.
And that code's incorrect anyway.
--
http://mail.python.org/mailman/listinfo/python-lis
"David E. Konerding DSD staff" <[EMAIL PROTECTED]> wrote:
>
>I don't really understand precisely what you're trying to do.
>
>First off, those aren't base pairs, they're bases. Only when you have
>double-stranded
>DNA (or RNA, or some other oddball cases) would they be base pairs.
Isn't that j
James Stroud wrote:
> I'm writing your name down and this is the last time I'm doing homework
> for you.
This won't help - she doesn't even know her name
(but google helps with that) ;-)
The fact that she uses E.coli ribosomal protein L1
strongly indicates that this is really homework.
...
> d
Thanks so much guys for you all your help. I've had a month to learn
python and do this for my project, I had the basics down but just kept
getting unstuck. I won't message again - promise! Hehehe, thanks again
everyone.
--
http://mail.python.org/mailman/listinfo/python-list
James Stroud wrote:
> nuttydevil wrote:
>
>> I have many notepad documents that all contain long chunks of genetic
>> code. They look something like this:
>>
>> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
>> tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
>> agcgtggac
nuttydevil wrote:
> I have many notepad documents that all contain long chunks of genetic
> code. They look something like this:
>
> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
> tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
> agcgtggacgtagctgttaacctcggcatcgacgctcgt
In article <[EMAIL PROTECTED]>, nuttydevil wrote:
> I have many notepad documents that all contain long chunks of genetic
> code. They look something like this:
>
> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
> tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
> agcgtgg
In article <[EMAIL PROTECTED]>,
nuttydevil <[EMAIL PROTECTED]> wrote:
>I have many notepad documents that all contain long chunks of genetic
>code. They look something like this:
>
>atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
>tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcg
Diez B. Roggisch wrote:
> nuttydevil schrieb:
>
>>I've tried various ways of doing this but keep coming unstuck along the
>>way. Has anyone got any suggestions for how they would tackle this
>>problem?
>>Thanks for any help recieved!
>
>
> Show us your ways, show us where you got stuck - then we
nuttydevil schrieb:
> I've tried various ways of doing this but keep coming unstuck along the
> way. Has anyone got any suggestions for how they would tackle this
> problem?
> Thanks for any help recieved!
Show us your ways, show us where you got stuck - then we'd might be able to
help you.
Diez
I have many notepad documents that all contain long chunks of genetic
code. They look something like this:
atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
agcgtggacgtagctgttaacctcggcatcgacgctcgtaaatctgaccagaacgtacgt
ggtgcaac
12 matches
Mail list logo
