print nucleotides, seq[-76]
last_part = line.rstrip()[-76 : ]
You all mean: seq[:-76] , right? (assuming you've already stripped
any junk off the end of the string)
Iain
--
http://mail.python.org/mailman/listinfo/python-list
On Thu, Aug 6, 2009 at 6:28 PM, Iain King iaink...@gmail.com wrote:
print nucleotides, seq[-76]
last_part = line.rstrip()[-76 : ]
You all mean: seq[:-76] , right? (assuming you've already stripped
any junk off the end of the string)
I think so, probably both of them
Iain King wrote:
print nucleotides, seq[-76]
last_part = line.rstrip()[-76 : ]
You all mean: seq[:-76] , right? (assuming you've already stripped
any junk off the end of the string)
The OP said cut out the last 76 letters (nucleotides) from each
individual sequence and send
On Aug 6, 11:34 am, MRAB pyt...@mrabarnett.plus.com wrote:
Iain King wrote:
print nucleotides, seq[-76]
last_part = line.rstrip()[-76 : ]
You all mean: seq[:-76] , right? (assuming you've already stripped
any junk off the end of the string)
The OP said cut out the last
Hi All, So here is the problem... I have a FASTA file (used for DNA
analyses) that looks like this:
...
gnl|SRA|SRR019045.10.1 SL-XAY_956090708:2:1:0:1028.1 length=152
NCTTTATTGTATAAATGAAGTTTCACTATATCGGACGAGCGGTTCAGCAGTCATTCCGAGAC
Dnia 06-08-2009 o 01:54:46 PeroMHC macma...@gmail.com wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut
Dnia 06-08-2009 o 01:54:46 PeroMHC macma...@gmail.com wrote:
This snippet represents 3 individual DNA sequences. Each sequences is
identified by the line starting with
The complete file has about 10 million individual sequences.
A simple enough problem, I want to read in this data, and cut
