Re: [R] Cannot use negative argument in function

On 29-02-2012, at 07:03, lidaky wrote: Hi, today i wrote a function in R of the type: index.refraction - function(Temp,Press, RH, CO2) When i try to plug a negative number in Temp, i got this type of error: n - index.refraction(Temp= -40,100,80,CO2) Messages d'avis : 1: In

Re: [R] indexing??

On Tue, Feb 28, 2012 at 11:42:32AM -0800, helin_susam wrote: Dear Petr Savicky, Actually, this is based on jackknife after bootstrap algorithm. In summary, I have a data set, and I want to compute some values by using this algorithm. Firstly, using bootstrap, I create some bootstrap

Re: [R] General question about GLMM and heterogeneity of variance

Sorry, I was not particularly clear. I ran my data through a GLM (the response variable is a proportion, and I ignored the random effects for the purposes of data exploration), and plotted the residuals against each of my predictor variables (some of which are continuous, some categorical). The

Re: [R] Interpreting the Results of GLM

Le mardi 28 février 2012 à 02:48 -0800, sazzle a écrit : Hi, I'm wondering if you can help me, this is a really simple query but I keep getting confused. I have run a GLM to see how boldness varies over time following a particular treatment. The results are as follows... Call: glm(formula

Re: [R] Installing package QRMlib

Ah yes, I can open it with Notepad...it reads the following: * installing *source* package 'QRMlib' ... ** Creating default NAMESPACE file ** libs ERROR: compilation failed for package 'QRMlib' * removing 'C:/PROGRA~1/R/R-214~1.1/bin/QRMLIB~1.RCH/QRMlib' -- View this message in context:

[R] Export nls object to text file

Hi all, I am new to R and have some trouble with exporting results from a non linear squares object (.nls), would be very thankful if anyone could help me. So what I'm doing is a Bass modelling of some data. The result is stored in the object Bass.nls. I want to export a matrix with the three

[R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

Hello R people, How can I compute the mean of the Pulse_rate column of the data frame or matrix from the following character object called str_got. It has 14 entries and each entry has 8 values, separated by commas. Please go thru the following R commands to know how I tried to unstring and

Re: [R] General question about GLMM and heterogeneity of variance

I will also post the above to the sig mixed models forum now. Thanks. -- View this message in context: http://r.789695.n4.nabble.com/General-question-about-GLMM-and-heterogeneity-of-variance-tp4424429p4431107.html Sent from the R help mailing list archive at Nabble.com.

[R] Does anyone knows a KMeans ++ package for R?

Dear all. I am searching for KMeans ++ for R. I cannot find it. Do you know any package with it? Best regards, Rui __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

On 29-02-2012, at 09:45, Aniruddha Mukherjee wrote: Hello R people, How can I compute the mean of the Pulse_rate column of the data frame or matrix from the following character object called str_got. It has 14 entries and each entry has 8 values, separated by commas. Please go thru the

Re: [R] Does anyone knows a KMeans ++ package for R?

Dear Rui, What ++ means? There is kmeans in stats package. Best Regards, Pascal Le 29/02/2012 19:20, Rui Esteves a écrit : Dear all. I am searching for KMeans ++ for R. I cannot find it. Do you know any package with it? Best regards, Rui __

Re: [R] Does anyone knows a KMeans ++ package for R?

Dear Pascal, From Wikipedia: In applied statistics, k-means++ is an algorithm for choosing the initial values (or seeds) for the k-means clustering algorithm. It was proposed in 2007 by David Arthur and Sergei Vassilvitskii, as an approximation algorithm for the NP-hard k-means problem—a way of

Re: [R] Does anyone knows a KMeans ++ package for R?

Dear Rui, Did you have a look at 'pracma' package? There is a 'kmeanspp' function. Best Regards, Pascal Le 29/02/2012 19:52, Rui Esteves a écrit : Dear Pascal, From Wikipedia: In applied statistics, k-means++ is an algorithm for choosing the initial values (or seeds) for the k-means

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

On 29-02-2012, at 11:49, Aniruddha Mukherjee wrote: Hello Berend. Many thanks for your prompt reply and that helped me a lot. One more thing, if you please explain, I shall be highly obliged. Why in my case (i.e. when stringsAsFactors was TRUE by default),

Re: [R] Export nls object to text file

You can save it as an R Data file using save() and then reload it with load() -- there's not a natural way to make it something that lives nicely in a text file (since an nls object is quite complex) -- if you are just going to be using the object again in R I'd recommend the first. If you need it

Re: [R] Using a FOR LOOP to name objects

In short, don't -- use a named list instead. Long answer: ?assign ?get Michael On Tue, Feb 28, 2012 at 10:40 PM, michaelyb cel81009...@gmail.com wrote: Hello, I am trying to use a for loop to name objects in each iteraction. As in the following example (which doesn't work quite well)

Re: [R] Database

I don't use Access but my general impression is that the advantages it brings will be similar to those brought by any other database: performance rather than ability -- they are both Turing complete after all, after some trickery on the SQL end. Databases allow much larger data sets than R

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

Hello Berend. Many thanks for your prompt reply and that helped me a lot. One more thing, if you please explain, I shall be highly obliged. Why in my case (i.e. when stringsAsFactors was TRUE by default), as.numeric(matr1$Pulse_rate) displays the following [1] 4 5 7 5 9 8 6 10 3 2

Re: [R] indexing??

Thanks, Dear Petr Savick. Your help is enough to solve my problem. With your help I've dealt with the problem. Many thanks for your effort, Sincerely, Helin -- View this message in context: http://r.789695.n4.nabble.com/indexing-tp4428210p4431168.html Sent from the R help mailing list

[R] Minimum curvature Interpolation in R?

Hi - Is there a Minimum Curvature interpolation function writen for R somewhere? Sometimes called minimum Curvature Splines I believe. Have searched the help-archive etc with no joy. Many thanks! -- Dr Paul E Brewin South Georgia Project Science Officer Shallow Marine Surveys Group PO Box

[R] equivalent from gladder and ladder from stata

Dear community, Apologies, I'm still pretty newbie. Anyway, I am performing linar regression analysis. As a common cause of non-normally distributed residuals is non-normally predictor variables, i'm interested in achieving the best transformation of the predictors. I've seen some commands at

[R] Error in Aggregate

Hi My dataframe looks like this data= id V1 V2 V3 V4 1 5 6 7 8 1 10 20 30 40 2 23 54 54 6 3 43 54 54 33 4 12 34 54 54 4 34 54 23 52 I have to sum by id I used command aggregate(data,by =list(data$id),FUN=sum) Error i face is Error in Summary.factor(c(1L, 1L, 1L, 1L, 1L), na.rm =

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

Factors are internally stored as integers (enums if you have used other programming languages) with a special label set -- it's more memory efficient than storing the whole string over and over. Michael On Wed, Feb 29, 2012 at 5:49 AM, Aniruddha Mukherjee aniruddha.mukher...@tcs.com wrote:

[R] Converting a function from Splus to R

I have a function written for Splus, when I run it in R I obtain get an error because the function has the elements 0.d0 and 2.d0. How can I change it to run in R? The function can be found in page 230 from http://www.stat.wisc.edu/~mchung/teaching/stat471/stat_computing.pdf Function is as

Re: [R] Bayesian Hidden Markov Models

Dear James, The distances are normalized between zero and 1, so in your case all of them will be zero. You can check that with res$Dist.for.model And do Q.NH(summary(res)[[1]]$beta, x=0) To obtain the common transition matrix. Cheers, Oscar On 29/2/12 03:59, monkeylan

[R] using jit

Dear R gurus, I'm trying to use jit package to parallel my computing do you put jit(2) /jit(1) in front of every loops? I got 8 nested loops in my code. many thanks yan __ R-help@r-project.org mailing list

Re: [R] Database

On 29/02/2012 12:45, R. Michael Weylandt wrote: I don't use Access but my general impression is that the advantages it brings will be similar to those brought by any other database: performance rather than ability -- they are both Turing complete after all, after some trickery on the SQL end.

Re: [R] Converting a function from Splus to R

Change the name to something syntactically valid? The problem is that you can't (well, you can, but it's ill advised) have variable names beginning with numbers. They don't seem to be used much so there won't be much trouble in that. Michael 2012/2/29 Freddy Hernández fhern...@gmail.com: I

Re: [R] Error in Aggregate

The error message is clear: your problem is that your data.frame (note the period) contains factors. Use str(data) -- also don't use data as it's a function name -- to see which ones and change as appropriate. Michael On Wed, Feb 29, 2012 at 7:16 AM, arunkumar akpbond...@gmail.com wrote: Hi

Re: [R] Converting a function from Splus to R

On 29-02-2012, at 14:02, Freddy Hernández wrote: I have a function written for Splus, when I run it in R I obtain get an error because the function has the elements 0.d0 and 2.d0. How can I change it to run in R? The function can be found in page 230 from

Re: [R] Good and modern Kernel Regression package in R with auto-bandwidth?

That's why I said you need the book. The details are all in the book. From: Michael [mailto:comtech@gmail.com] Sent: Thursday, February 23, 2012 1:49 PM To: Liaw, Andy Cc: r-help Subject: Re: [R] Good and modern Kernel Regression package in R with

Re: [R] Installing package QRMlib

I wouldn't see myself as an experienced R user soI would appreciate if anyone is able to give me a clear set of instructions on how to install and load QRMlib. The steps I've followed are: 1: Download 'QRMlib_1.4.5.1.tar.gz' from http://cran.r-project.org/src/contrib/Archive/QRMlib/ to my local

Re: [R] Database

On Tue, Feb 28, 2012 at 6:06 PM, Trying To learn again tryingtolearnag...@gmail.com wrote: Hi all, I´m new using Access. I see that many things that you can do on Access you can do on CRAN R but not on contrary. My question is: Is there any manual with examples comparing how to do data base

Re: [R] Converting a function from Splus to R

On 29/02/2012 13:24, R. Michael Weylandt wrote: Change the name to something syntactically valid? The problem is that you can't (well, you can, but it's ill advised) have variable names beginning with numbers. They don't seem to be used much so there won't be much trouble in that. I think

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

On 12-02-29 8:16 AM, R. Michael Weylandt wrote: Factors are internally stored as integers (enums if you have used other programming languages) with a special label set -- it's more memory efficient than storing the whole string over and over. That was one of the original justifications, but

Re: [R] Installing package QRMlib

Well, because QRMlib interfaces C routines (IIRC), the error message is pretty indicative, i.e. these routines cannot be compiled. Now, without further information there is not much to recommend, but: 1) check your RTools installation 2) Ask the package maintainer (cc'ed) when he will

[R] Computing line= for mtext

I want to right-justify a vector of numbers in the right margin of a low-level plot. For this I need to compute the line parameter to give to mtext. Is this the correct scalable calculation? par(mar=c(4,3,1,5)); plot(1:20) s - 'abcde'; w=strwidth(s, units='inches')/par('cin')[1] mtext(s,

Re: [R] Converting a function from Splus to R

Oh...that does make more sense -- seemed like a rather odd choice of variable name. Michael On Wed, Feb 29, 2012 at 8:40 AM, Prof Brian Ripley rip...@stats.ox.ac.uk wrote: On 29/02/2012 13:24, R. Michael Weylandt wrote: Change the name to something syntactically valid? The problem is that

Re: [R] Error occurred during mean calculation of a column of a data frame, which is apparently contents numeric data

On 29/02/2012 13:41, Duncan Murdoch wrote: On 12-02-29 8:16 AM, R. Michael Weylandt wrote: Factors are internally stored as integers (enums if you have used other programming languages) with a special label set -- it's more memory efficient than storing the whole string over and over. That

[R] How can I avoid the warning messages when calling DAAG package?

Dear R users, I'm a newbie for R and want to ask some basic questions. So, after I open the R software, I typed library(DAAG). Then, I get massive warning messages as shown below. Why does it happen? Also, here are few specific questions regarding each message. 1) Loading required package:

[R] R 2.14.2 is released + R anniversary

The build system rolled up R-2.14.2.tar.gz (codename Gift-Getting Season) at 9:00 this morning. This is intended to be the final round-up release of the 2.14 series; see the list below for details. (The codename is still not part of the actual sources. That feature will have to wait for

[R] simulating scores

I am currently looking at rugby scores and I have predicted 'T', 'C', 'P' and 'D' by using the predict function for a weekend of results. score -5*T + 2*C + 3*P+ 3*Dr score So the output from the score function above is 12 values, as follows. Where 1 to 12 represent the teams involved in the

[R] Principal Component Analysis

Dear R buddies, I’m trying to run Principal Component Analysis, package princomp: http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html. My question is: why do I get different results with pca = princomp (x, cor = TRUE) and pca = princomp (x, cor = FALSE) even when I

Re: [R] Principal Component Analysis

Hi, On Wed, Feb 29, 2012 at 9:52 AM, Blaz Simcic blazsim...@yahoo.com wrote: Dear R buddies, I’m trying to run Principal Component Analysis, package princomp: http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html. I'm going to assume you actually mean the princomp()

[R] puzzling results from logistic regression

Hi all, As you can see from below, the result is strange... I would imagined that the bb result should be much higher and close to 1, any way to improve the fit? Any other classification methods? Thank you! data=data.frame(y=rep(c(0, 1), times=100), x=1:200) aa=glm(y~x, data=data,

[R] Question about hierarchical clustering

Dear List i'm performing hierarchical clustering analysis with ward method. My best clusters are choosen according to silhouette score... Now I'd like to select the most representative term in each cluster. Do you think that searching for medoids could be a good idea? Here is the code that I use

Re: [R] Does anyone knows a KMeans ++ package for R?

I believe there is also an example of how to select initial values for k-means in Modern and Applied Statistics with S (Venables and Ripley). Ken On 02/29/12, Pascal Oettli wrote: Dear Rui, Did you have a look at 'pracma' package? There is a 'kmeanspp' function. Best Regards, Pascal

Re: [R] Principal Component Analysis

x - data.frame(a=rnorm(100), b=rnorm(100), d=rnorm(100)) prcomp(x, scale=T) prcomp(scale(x), scale=F) The above will give you the same thing. This should be the case because the correlation matrix is the same as the covariance of the scaled and centered original data. FWIW Stephen On

Re: [R] puzzling results from logistic regression

On Wed, Feb 29, 2012 at 10:02 AM, Michael comtech@gmail.com wrote: Hi all, As you can see from below, the result is strange... Not really. I would imagined that the bb result should be much higher and close to 1, any way to improve the fit? Any other classification methods? Thank

Re: [R] Cannot use negative argument in function

Do an str() on the data. It looks like temp is a factor and I doubt that factors can be negative. John Kane Kingston ON Canada -Original Message- From: svfil...@alaska.edu Sent: Tue, 28 Feb 2012 22:03:19 -0800 (PST) To: r-help@r-project.org Subject: [R] Cannot use negative

Re: [R] puzzling results from logistic regression

How did you see it's non-significant? Thanks! On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee sarah.gos...@gmail.comwrote: On Wed, Feb 29, 2012 at 10:02 AM, Michael comtech@gmail.com wrote: Hi all, As you can see from below, the result is strange... Not really. I would imagined

Re: [R] puzzling results from logistic regression

Formally, look at Pr(|z|). Informally, look at the null and residual deviances from print(aa). Michael On Wed, Feb 29, 2012 at 10:14 AM, Michael comtech@gmail.com wrote: How did you see it's non-significant? Thanks! On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee

Re: [R] Database

It all depends on what you are doing but R is pretty powerful. I have never used Access so I don't know what it can do but I have played around with othe dbs at a very basic level and most things I did could be done quite easily in R : Sheer data set size could be a problem but unless you

[R] codon usage bias

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: newdata5 $testseq [1] agtgagatgatagatagatagatagatagatagatagaccagata

Re: [R] Export nls object to text file

Thanks very much for this. I will try this. -- View this message in context: http://r.789695.n4.nabble.com/Export-nls-object-to-text-file-tp4431039p4431752.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org

[R] How to remove an object that is loaded every time R is opened?

Dear R users, I'm a newbie and have another basic question that you guys can answer for me. So, I've been noticing that an object (data frame) called FossilFuel is loaded as default when I first open up the R (see below). I created this data frame a while ago which is a data set for tutorial and I

Re: [R] Installing package QRMlib

QRMlib built without errors on my WIndows machine. Here's the resulting zip binary: http://commondatastorage.googleapis.com/jthetzel-public/QRMlib_1.4.5.1.zip Will that install on your machine? Jeremy DT54321 wrote I wouldn't see myself as an experienced R user soI would appreciate if

Re: [R] Cleaning up messy Excel data

(mydata - as.factor(c(1,2,3, 2, 5, 2))) str(mydata) newdata - as.character(mydata) newdata[newdata==2] - 0 newdata - as.numeric(newdata) str(newdata) We really need to keep Excel (and other spreadsheets) out of peoples hands. John Kane Kingston ON Canada -Original Message- From:

Re: [R] ts.plot and x axes customization

On Wed, Feb 29, 2012 at 1:56 AM, Jochem Schuster jochem.schus...@web.dewrote: Hello, thank you very much for your answer. In the following, I will provide my recent code and try to explain again: series1 = ts(x$france start=c(2000,1), frequency=4) series2 = ts(x$germany, start=c(2000,1),

Re: [R] How to remove an object that is loaded every time R is opened?

Put --no-restore On your startup command to start with a clean session. On Wednesday, February 29, 2012, Jason Love jason.love1...@gmail.com wrote: Dear R users, I'm a newbie and have another basic question that you guys can answer for me. So, I've been noticing that an object (data frame)

Re: [R] puzzling results from logistic regression

Please folks ... On Wed, Feb 29, 2012 at 7:14 AM, Michael comtech@gmail.com wrote: How did you see it's non-significant? You need to take or review a basic statistics course. Pr(|Z|) is your P value. Thanks! On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee sarah.gos...@gmail.comwrote:

Re: [R] codon usage bias

This question sounds more suited for the Bioconductor list which focuses on R tools for genetic/bioinformatic computation. It's an active and very friendly list and I think one doesn't have to subscribe to post (but doing so certainly isn't a bad idea). Michael On Feb 29, 2012, at 9:55 AM,

Re: [R] memory management

* William Dunlap jqha...@gvopb.pbz [2012-02-28 23:06:54 +]: You need to walk through the objects, checking for environments on each component or attribute of an object. so why doesn't object.size do that? f - function(n) { + d - data.frame(y = rnorm(n), x = rnorm(n)) + lm(y

Re: [R] Gamm and post comparison

On Wed, 2012-02-22 at 10:55 -0800, RHam wrote: My data set consist of number of calls (lcin) across Day. I am looking for activity differences between three features (4 sites per feature). I am also looking for peaks of activity across time (Day). I am using a gamm since I believe these are

Re: [R] How to remove an object that is loaded every time R is opened?

Hi Jason If you close an R session and save without choosing a filename, a file called .RData will be created. Open a new session and type getwd(). Then have a look in the named file with your folder options set to Show Hidden Files. Deleting or renaming this file should remove the imported

[R] Coding help

Dear Group, I have the following dataset: ID REPI DV CONC SS 11 156.84 116 0 1 2 146.56 116 0 13 115.13 116 0 14 207.81 116 0 15 129.53 116 0 16 151.48 116 0 17 158.95 116 0 18 192.37 116 0 19 32.97 116 0 1 10

Re: [R] memory management

I do a lot of strsplit, unlist, subsetting, so I could imagine why the RSS is triple the total size of my data if all the intermediate results are not released. I can only give some generalities about that. Using lots of small chunks of memory (like short strings) may cause fragmentation

Re: [R] memory management

Le mercredi 29 février 2012 à 11:42 -0500, Sam Steingold a écrit : * William Dunlap jqha...@gvopb.pbz [2012-02-28 23:06:54 +]: You need to walk through the objects, checking for environments on each component or attribute of an object. so why doesn't object.size do that? f -

[R] How are the coefficients for the ur.ers, type DF-GLS calculated?

I need some real help on this, really stuck how are the coefficients for ur.ers(y, type = c(DF-GLS, P-test), model = c(constant, trend), lag.max = 0) The max lag is set at zero, so the regression should simply be Diff(zt) = a*z(t-1) where a is the value i'm trying to find and z(t)'s are

[R] use of subset in lme function

Dear all, I have an issue concerning the lme function and I couldn't find the solution elsewhere. I have a data frame with id, Ages, Parameter1 and Parameter2. The Ages can belong to one of two categories early or late. Then for example an id can have several values of Parameter1 at different

Re: [R] How to replace the values in a column

Hello, Try the following. (In Andrija's code I've changed 'df' to 'DF', 'df' is a R function name) DF - read.table( ... etc ... tc - textConnection( Column1(Gen)Column2(Name) A_1 Wynda A_2 A_2 B_1

Re: [R] Installing package QRMlib

That worked! Thanks a lot Jeremy. -- View this message in context: http://r.789695.n4.nabble.com/Installing-package-QRMlib-tp4425269p4431895.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list

Re: [R] Error: could not find function hier.part

Thank you Michael. I also wrote to the author of this program, Palph, he suggested the same thing. It worked!! It is a very useful tool. In case for someone who is interested, I found the package here: http://cran.r-project.org/web/packages/hier.part/ -- View this message in context:

[R] Help please

Hi everyone, I was using rattle. I used a database with 4 individuals and 50 variables. Reading the database was OK and that was made by rattle but when y was trying to draw the tree, rattle shows the image attached. Please help me. Raúl Fernández

[R] orthogonal distance regression package?

Hello, I am extremely new to R and have found some leads to this question in the archives, but I am still a bit uncertain. I am looking for an R package to carry out orthogonal distance regression. I found some answers regarding Deming regression and Total Least Squares regression, but I was

[R] How to simulate demographic (specifically, sub-group) data?

I am a relatively new R user and have recently built a multivariate dataset without the demographic information. Is there any package or code to simulate subgroup dataset (race, sex, age) using R? Any help would be appreciated. Thanks, Alok [[alternative HTML version deleted]]

[R] How to extract numerical values from time series forecast

hi all. i'm busy with some time series data, starting from an earlier period until the current day. i have created a time series forecast taking into account the entire data from the earlier date up until 2007, using the forecast package for R. i am comparing this forecasted data to the actual/

[R] R newbie: Installation of package reshape exit status not 0

Hello, sorry i'm an R newbie and wan't to install ggplot2 on my ubuntu system. during installation i got the error warning: Warnmeldung: In install.packages(reshape) : Installation des Pakets 'reshape' hatte Exit-Status ungleich 0 Please, give me a idea, how can i fix this error/warning --

Re: [R] Converting a function from Splus to R

1.0d+0 is Fortran (not C) for a double precision value, 1.0 * 10^0. 1.0e+0 is Fortran for a single precision value, 1.0 * 10^0 and C for a double precision value. Bill Dunlap Spotfire, TIBCO Software wdunlap tibco.com -Original Message- From: r-help-boun...@r-project.org

Re: [R] Help please

On 29.02.2012 17:36, Raúl Fernández Naranjo wrote: Hi everyone, I was using rattle. I used a database with 4 individuals and 50 variables. Reading the database was OK and that was made by rattle but when y was trying to draw the tree, rattle shows the image attached. And have

Re: [R] To define a function which includes two functions as arguments such as plot and text

On 28.02.2012 07:04, Yashwanth M.R wrote: Hi Mr. Uwe Ligges, Yashwanth M.R, this is the R-help mailing list, not my personal mail account (and Mr. is inappropriate in any case). I really thankful for the reply. I even tried the same, means writing the new function.

Re: [R] R newbie: Installation of package reshape exit status not 0

On 29.02.2012 18:34, ibid...@gmx.at wrote: Hello, sorry i'm an R newbie and wan't to install ggplot2 on my ubuntu system. during installation i got the error warning: Warnmeldung: In install.packages(reshape) : Installation des Pakets 'reshape' hatte Exit-Status ungleich 0 Please, give me

Re: [R] R newbie: Installation of package reshape exit status not 0

On Feb 29, 2012, at 12:34 PM, ibid...@gmx.at wrote: Hello, sorry i'm an R newbie and wan't to install ggplot2 on my ubuntu system. during installation i got the error warning: Warnmeldung: In install.packages(reshape) : Installation des Pakets 'reshape' hatte Exit-Status ungleich 0 Please,

Re: [R] memory management

* Milan Bouchet-Valat anyvzv...@pyho.se [2012-02-29 18:18:50 +0100]: I think you're simply hitting a (terrible) OS limitation. Linux is very often not able to reclaim the memory R has used because it's fragmented. The OS can only get the pages back if nothing is above them, and most of the

Re: [R] How to simulate demographic (specifically, sub-group) data?

Hi Alok See ?createCovariates in MSToolkit. Best wishes Chris Chris Campbell MANGO SOLUTIONS Data Analysis that Delivers +44 1249 705450 -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On Behalf Of Bhupatkar, Alok Sent: 29 February 2012

Re: [R] equivalent from gladder and ladder from stata

From your description, I believe the ladder function in the HH package is what you are looking for. ## install.packages(HH) ## if necessary library(HH) data(tv) ladder(life.exp ~ ppl.per.phys, data=tv, scales=list(relation=free)) Rich On Wed, Feb 29, 2012 at 6:21 AM, agent dunham

Re: [R] orthogonal distance regression package?

On Wed, Feb 29, 2012 at 7:53 AM, Adam Waytz a-wa...@kellogg.northwestern.edu wrote: Hello, I am extremely new to R and have found some leads to this question in the archives, but I am still a bit uncertain. I am looking for an R package to carry out orthogonal distance regression.  I

Re: [R] orthogonal distance regression package?

In the age of google, I have found that concepts such as these are more complex than what Wikipedia provides. Going far beyond a cursory search, it appeared to me there are subtle differences between these terms. I was hoping this knowledgeable community could provide insight on an R package

[R] function for filtering and deleting vector entries

Dear helpers I have two data sets saved as vectors (temperature and velocity). Now I need to take out a span of temperature and its corresponding velocity in the other vector. How can I achieve that? I tried to write a function,which takes a vector entry and then decides wether to delete the

Re: [R] Coding help

On Wed, Feb 29, 2012 at 11:58:04AM -0500, Ayyappa Chaturvedula wrote: Dear Group, I have the following dataset: ID REPI DV CONC SS 11 156.84 116 0 1 2 146.56 116 0 13 115.13 116 0 14 207.81 116 0 15 129.53 116 0 16 151.48 116 0

Re: [R] Computing line= for mtext

Frank, This can be done directly with a variant of the panel.axis function. See function panel.axis.right in the HH package. This was provided for me by David Winsemius in response to my query on this list in October 2011 https://stat.ethz.ch/pipermail/r-help/2011-October/292806.html The email

Re: [R] Quantile scores as dependent variables.. an R and general method question

On Tue, Feb 28, 2012 at 3:54 PM, Rob James aetiolo...@gmail.com wrote: I have a dataset that does not include native scores, but only serial quantile rankings for a set of units. Clearly these observations are dependent (in that you can't alter one observation without also altering others).

Re: [R] orthogonal distance regression package?

Hi: I can't find it anywhere on the internet but I have a book that shows that, as long as the SVD of the X matrix can be obtained, then the coefficient solution to TLS ( least angle regression ) is only a function of the eigenvectors. Therefore, principal components can be used to obtain the

Re: [R] Volcano Plot

On 02/28/2012 08:13 AM, aishsk wrote: Hi I am using the ggplot2 package for the volcano plot and I am using the following code for the same: g = ggplot(data=data, aes(x=data[11], y=-log10(data[12]), colour=threshold)) + + geom_point(alpha=0.4, size=1.75) + + opts(legend.position = none) + +

Re: [R] Frequencies from x/y data into a 2d table (for 3d histogram or heatmap)

Hi Ralf, have you solved your problem?! If so, could you share? I have the same problem... Best, Marcio On 3/25/10 6:03 PM, Ralf B wrote: Hi all, I have simple x/y data from screen recording in a sequence: number,x,y 1,10,30 1,20, 1,43,110 1,74,18 1,88,112 and would like

Re: [R] orthogonal distance regression package?

My understanding is that TLS, EIV, and orthogonal regression are closely related but separate concepts. If you read the 'Talk' at the Wikipedia page referenced below, you will see that many people have terminology problems as well. My take is that TLS is a special case of EIV and orthogonal

[R] Question about tables in bigtabulate

I have a large file backed big. matrix, with millions of rows and 20 columns. The columns contain data that I simply need to tabulate. There are a few dozen unique values. and I just want a frequency count Test code with a small big matrix. library(bigmemory) library(bigtabulate) test -

Re: [R] orthogonal distance regression package?

Thanks all. This is tremendously helpful. Best, Adam On Feb 29, 2012, at 12:58 PM, David Reiner wrote: My understanding is that TLS, EIV, and orthogonal regression are closely related but separate concepts. If you read the 'Talk' at the Wikipedia page referenced below, you will see

Re: [R] memory management

On Wed, 29 Feb 2012, Sam Steingold wrote: * Milan Bouchet-Valat anyvzv...@pyho.se [2012-02-29 18:18:50 +0100]: I think you're simply hitting a (terrible) OS limitation. Linux is very often not able to reclaim the memory R has used because it's fragmented. The OS can only get the pages back if

Re: [R] How can I avoid the warning messages when calling DAAG package?

On 29.02.2012 15:19, Jason Love wrote: Dear R users, I'm a newbie for R and want to ask some basic questions. So, after I open the R software, I typed library(DAAG). Then, I get massive warning messages as shown below. Why does it happen? Also, here are few specific questions regarding

  1   2   >