> I do a lot of strsplit, unlist, & subsetting, so I could imagine why
> the RSS is triple the total size of my data if all the intermediate
> results are not released.
I can only give some generalities about that. Using lots of
small chunks of memory (like short strings) may cause fragmentation
Dear Group,
I have the following dataset:
ID REPI DV CONC SS
11 156.84 116 0
1 2 146.56 116 0
13 115.13 116 0
14 207.81 116 0
15 129.53 116 0
16 151.48 116 0
17 158.95 116 0
18 192.37 116 0
19 32.97 116 0
1 10
Hi Jason
If you close an R session and save without choosing a filename, a file called
.RData will be created. Open a new session and type getwd(). Then have a look
in the named file with your folder options set to Show Hidden Files. Deleting
or renaming this file should remove the imported obj
On Wed, 2012-02-22 at 10:55 -0800, RHam wrote:
> My data set consist of number of calls (lcin) across Day. I am looking for
> activity differences between three features (4 sites per feature). I am also
> looking for peaks of activity across time (Day). I am using a gamm since I
> believe these are
> * William Dunlap [2012-02-28 23:06:54 +]:
>
> You need to walk through the objects, checking for environments on
> each component or attribute of an object.
so why doesn't object.size do that?
> > f <- function(n) {
> + d <- data.frame(y = rnorm(n), x = rnorm(n))
> + lm(y ~ poly(
This question sounds more suited for the Bioconductor list which focuses on R
tools for genetic/bioinformatic computation. It's an active and very friendly
list and I think one doesn't have to subscribe to post (but doing so certainly
isn't a bad idea).
Michael
On Feb 29, 2012, at 9:55 AM, aoi
Please folks ...
On Wed, Feb 29, 2012 at 7:14 AM, Michael wrote:
> How did you see it's non-significant?
You need to take or review a basic statistics course. Pr(>|Z|) is your P value.
>
> Thanks!
>
> On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee wrote:
>
>> On Wed, Feb 29, 2012 at 10:02 AM, Mi
Put
--no-restore
On your startup command to start with a clean session.
On Wednesday, February 29, 2012, Jason Love
wrote:
> Dear R users,
> I'm a newbie and have another basic question that you guys can answer for
> me.
> So, I've been noticing that an object (data frame) called "FossilFuel" is
On Wed, Feb 29, 2012 at 1:56 AM, Jochem Schuster wrote:
> Hello,
>
> thank you very much for your answer. In the following, I will provide my
> recent code and try to explain again:
>
> series1 = ts(x$france start=c(2000,1), frequency=4)
> series2 = ts(x$germany, start=c(2000,1), frequency=4)
> ti
(mydata <- as.factor(c("1","2","3", ">2", "5", ">2")))
str(mydata)
newdata <- as.character(mydata)
newdata[newdata==">2"] <- 0
newdata <- as.numeric(newdata)
str(newdata)
We really need to keep Excel (and other spreadsheets) out of peoples hands.
John Kane
Kingston ON Canada
> -Original
QRMlib built without errors on my WIndows machine. Here's the resulting zip
binary:
http://commondatastorage.googleapis.com/jthetzel-public/QRMlib_1.4.5.1.zip
Will that install on your machine?
Jeremy
DT54321 wrote
>
> I wouldn't see myself as an experienced R user soI would appreciate if
>
Dear R users,
I'm a newbie and have another basic question that you guys can answer for
me.
So, I've been noticing that an object (data frame) called "FossilFuel" is
loaded as default when I first open up the R (see below).
I created this data frame a while ago which is a data set for tutorial and
Thanks very much for this.
I will try this.
--
View this message in context:
http://r.789695.n4.nabble.com/Export-nls-object-to-text-file-tp4431039p4431752.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccagata"
It all depends on what you are doing but R is pretty powerful. I have never
used Access so I don't know what it can do but I have played around with othe
dbs at a very basic level and most things I did could be done quite easily in R
: Sheer data set size could be a problem but unless you have
Formally, look at Pr(>|z|). Informally, look at the null and residual
deviances from print(aa).
Michael
On Wed, Feb 29, 2012 at 10:14 AM, Michael wrote:
> How did you see it's non-significant?
>
> Thanks!
>
> On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee wrote:
>
>> On Wed, Feb 29, 2012 at 10:02
How did you see it's non-significant?
Thanks!
On Wed, Feb 29, 2012 at 9:10 AM, Sarah Goslee wrote:
> On Wed, Feb 29, 2012 at 10:02 AM, Michael wrote:
> > Hi all,
> >
> > As you can see from below, the result is strange...
>
> Not really.
>
> > I would imagined that the bb result should be much
Do an str() on the data. It looks like temp is a factor and I doubt that
factors can be negative.
John Kane
Kingston ON Canada
> -Original Message-
> From: svfil...@alaska.edu
> Sent: Tue, 28 Feb 2012 22:03:19 -0800 (PST)
> To: r-help@r-project.org
> Subject: [R] Cannot use negative ar
On Wed, Feb 29, 2012 at 10:02 AM, Michael wrote:
> Hi all,
>
> As you can see from below, the result is strange...
Not really.
> I would imagined that the bb result should be much higher and close to 1,
> any way to improve the fit?
>
> Any other classification methods?
>
> Thank you!
>
> data=d
x <- data.frame(a=rnorm(100), b=rnorm(100), d=rnorm(100))
prcomp(x, scale=T)
prcomp(scale(x), scale=F)
The above will give you the same thing. This should be the case because
the correlation matrix is the same as the covariance of the scaled and
centered original data.
FWIW
Stephen
On 02/2
I believe there is also an example of how to select initial values for k-means
in Modern and Applied Statistics with S (Venables and Ripley).
Ken
On 02/29/12, Pascal Oettli wrote:
> Dear Rui,
>
> Did you have a look at 'pracma' package? There is a 'kmeanspp' function.
>
> Best Regards,
> Pasc
Dear List i'm performing hierarchical clustering analysis with ward method.
My best clusters are choosen according to silhouette score...
Now I'd like to select the most representative term in each cluster.
Do you think that searching for medoids could be a good idea?
Here is the code that I use a
Hi all,
As you can see from below, the result is strange...
I would imagined that the bb result should be much higher and close to 1,
any way to improve the fit?
Any other classification methods?
Thank you!
data=data.frame(y=rep(c(0, 1), times=100), x=1:200)
aa=glm(y~x, data=data, family=binom
Hi,
On Wed, Feb 29, 2012 at 9:52 AM, Blaz Simcic wrote:
> Dear R buddies,
> I’m trying to run Principal Component Analysis, package
> princomp:
> http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html.
I'm going to assume you actually mean the princomp() function.
> My questio
Dear R buddies,
Iâm trying to run Principal Component Analysis, package
princomp:
http://stat.ethz.ch/R-manual/R-patched/library/stats/html/princomp.html.
My question is: why do I get different results with pca =
princomp (x, cor = TRUE) and pca = princomp (x, cor = FALSE) even when I
standardi
I am currently looking at rugby scores and I have predicted 'T', 'C', 'P' and
'D' by using the predict function for a weekend of results.
score <-5*T + 2*C + 3*P+ 3*Dr
score
So the output from the score function above is 12 values, as follows. Where
1 to 12 represent the teams involved in the ga
The build system rolled up R-2.14.2.tar.gz (codename "Gift-Getting Season") at
9:00 this morning. This is intended to be the final round-up release of the
2.14 series; see the list below for details.
(The codename is still not part of the actual sources. That feature will have
to wait for 2.15.
Dear R users,
I'm a newbie for R and want to ask some basic questions.
So, after I open the R software, I typed library(DAAG). Then, I get massive
warning messages as shown below.
Why does it happen?
Also, here are few specific questions regarding each message.
1) Loading required package: MAS
On 29/02/2012 13:41, Duncan Murdoch wrote:
On 12-02-29 8:16 AM, R. Michael Weylandt wrote:
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
That was
Oh...that does make more sense -- seemed like a rather odd choice of
variable name.
Michael
On Wed, Feb 29, 2012 at 8:40 AM, Prof Brian Ripley
wrote:
> On 29/02/2012 13:24, R. Michael Weylandt wrote:
>>
>> Change the name to something syntactically valid? The problem is that
>> you can't (well,
I want to right-justify a vector of numbers in the right margin of a
low-level plot. For this I need to compute the line parameter to give to
mtext. Is this the correct scalable calculation?
par(mar=c(4,3,1,5)); plot(1:20)
s <- 'abcde'; w=strwidth(s, units='inches')/par('cin')[1]
mtext(s, side=4
Well, because QRMlib interfaces C routines (IIRC), the error message is pretty
indicative, i.e. these routines cannot be compiled. Now, without further
information there is not much to recommend, but:
1) check your RTools installation
2) Ask the package maintainer (cc'ed) when he will re-release
On 12-02-29 8:16 AM, R. Michael Weylandt wrote:
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
That was one of the original justifications, but cha
On 29/02/2012 13:24, R. Michael Weylandt wrote:
Change the name to something syntactically valid? The problem is that
you can't (well, you can, but it's ill advised) have variable names
beginning with numbers. They don't seem to be used much so there
won't be much trouble in that.
I think that
On Tue, Feb 28, 2012 at 6:06 PM, Trying To learn again
wrote:
> Hi all,
>
> I´m new using Access. I see that many things that you can do on Access you
> can do on CRAN R but not on contrary.
>
> My question is: Is there any manual with examples comparing how to do data
> base analysis on access an
I wouldn't see myself as an experienced R user soI would appreciate if anyone
is able to give me a clear set of instructions on how to install and load
QRMlib. The steps I've followed are:
1: Download 'QRMlib_1.4.5.1.tar.gz' from
http://cran.r-project.org/src/contrib/Archive/QRMlib/ to my local fo
That's why I said you need the book. The details are all in the book.
From: Michael [mailto:comtech@gmail.com]
Sent: Thursday, February 23, 2012 1:49 PM
To: Liaw, Andy
Cc: r-help
Subject: Re: [R] Good and modern Kernel Regression package in R with
auto-bandwi
On 29-02-2012, at 14:02, Freddy Hernández wrote:
> I have a function written for Splus, when I run it in R I obtain get an error
> because the function has the elements "0.d0" and "2.d0". How can I change it
> to run in R?
>
> The function can be found in page 230 from
> http://www.stat.wisc.edu
The error message is clear: your problem is that your data.frame (note
the period) contains factors. Use str(data) -- also don't use data as
it's a function name -- to see which ones and change as appropriate.
Michael
On Wed, Feb 29, 2012 at 7:16 AM, arunkumar wrote:
> Hi
>
> My dataframe l
Change the name to something syntactically valid? The problem is that
you can't (well, you can, but it's ill advised) have variable names
beginning with numbers. They don't seem to be used much so there
won't be much trouble in that.
Michael
2012/2/29 Freddy Hernández :
> I have a function writt
On 29/02/2012 12:45, R. Michael Weylandt wrote:
I don't use Access but my general impression is that the advantages it
brings will be similar to those brought by any other database:
performance rather than ability -- they are both Turing complete after
all, after some trickery on the SQL end.
Da
Dear R gurus,
I'm trying to use jit package to parallel my computing
do you put jit(2) /jit(1) in front of every loops? I got 8 nested loops
in my code.
many thanks
yan
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-he
Dear James,
The distances are normalized between zero and 1, so in your case all of them
will be zero. You can check that with
> res$Dist.for.model
And do
> Q.NH(summary(res)[[1]]$beta, x=0)
To obtain the common transition matrix.
Cheers,
Oscar
On 29/2/12 03:59, "monkeylan" wrote:
> D
I have a function written for Splus, when I run it in R I obtain get an error
because the function has the elements "0.d0" and "2.d0". How can I change it
to run in R?
The function can be found in page 230 from
http://www.stat.wisc.edu/~mchung/teaching/stat471/stat_computing.pdf
Function is as f
Factors are internally stored as integers (enums if you have used
other programming languages) with a special label set -- it's more
memory efficient than storing the whole string over and over.
Michael
On Wed, Feb 29, 2012 at 5:49 AM, Aniruddha Mukherjee
wrote:
> Hello Berend.
>
> Many thanks f
Hi
My dataframe looks like this
data=
id V1 V2 V3 V4
1 5 6 7 8
1 10 20 30 40
2 23 54 54 6
3 43 54 54 33
4 12 34 54 54
4 34 54 23 52
I have to sum by id
I used command aggregate(data,by =list(data$id),FUN=sum)
Error i face is
Error in Summary.factor(c(1L, 1L, 1L, 1L, 1L), na.rm = FALS
Dear community,
Apologies, I'm still pretty newbie. Anyway, I am performing linar regression
analysis. As a common cause of non-normally distributed residuals is
non-normally predictor variables, i'm interested in achieving the best
transformation of the predictors.
I've seen some commands at R,
Hi - Is there a Minimum Curvature interpolation function writen for R
somewhere? Sometimes called minimum Curvature Splines I believe. Have
searched the help-archive etc with no joy.
Many thanks!
--
Dr Paul E Brewin
South Georgia Project Science Officer
Shallow Marine Surveys Group
PO Box 598
Thanks, Dear Petr Savick.
Your help is enough to solve my problem. With your help I've dealt with the
problem.
Many thanks for your effort,
Sincerely,
Helin
--
View this message in context:
http://r.789695.n4.nabble.com/indexing-tp4428210p4431168.html
Sent from the R help mailing list archiv
Hello Berend.
Many thanks for your prompt reply and that helped me a lot. One more
thing, if you please explain, I shall be highly obliged.
Why in my case (i.e. when stringsAsFactors was TRUE by default),
> as.numeric(matr1$Pulse_rate)
displays the following
[1] 4 5 7 5 9 8 6 10 3 2
I don't use Access but my general impression is that the advantages it
brings will be similar to those brought by any other database:
performance rather than ability -- they are both Turing complete after
all, after some trickery on the SQL end.
Databases allow much larger data sets than R current
In short, don't -- use a named list instead.
Long answer:
?assign
?get
Michael
On Tue, Feb 28, 2012 at 10:40 PM, michaelyb wrote:
> Hello,
>
> I am trying to use a for loop to name objects in each iteraction. As in the
> following example (which doesn't work quite well)
>
> my_list<-c("A","B",
You can save it as an R Data file using save() and then reload it with
load() -- there's not a natural way to make it something that lives
nicely in a text file (since an nls object is quite complex) -- if you
are just going to be using the object again in R I'd recommend the
first. If you need it
On 29-02-2012, at 11:49, Aniruddha Mukherjee wrote:
>
> Hello Berend.
>
> Many thanks for your prompt reply and that helped me a lot. One more thing,
> if you please explain, I shall be highly obliged.
> Why in my case (i.e. when stringsAsFactors was TRUE by default),
> > as.numeric(matr1$P
Dear Rui,
Did you have a look at 'pracma' package? There is a 'kmeanspp' function.
Best Regards,
Pascal
Le 29/02/2012 19:52, Rui Esteves a écrit :
Dear Pascal,
From Wikipedia:
In applied statistics, k-means++ is an algorithm for choosing the
initial values (or "seeds") for the k-means clu
Dear Pascal,
>From Wikipedia:
In applied statistics, k-means++ is an algorithm for choosing the
initial values (or "seeds") for the k-means clustering algorithm. It
was proposed in 2007 by David Arthur and Sergei Vassilvitskii, as an
approximation algorithm for the NP-hard k-means problem—a way o
Dear Rui,
What "++" means? There is kmeans in "stats" package.
Best Regards,
Pascal
Le 29/02/2012 19:20, Rui Esteves a écrit :
Dear all.
I am searching for KMeans ++ for R. I cannot find it.
Do you know any package with it?
Best regards,
Rui
__
On 29-02-2012, at 09:45, Aniruddha Mukherjee wrote:
> Hello R people,
>
> How can I compute the mean of the "Pulse_rate" column of the data frame or
> matrix from the following character object called "str_got". It has 14
> entries and each entry has 8 values, separated by commas. Please go th
Dear all.
I am searching for KMeans ++ for R. I cannot find it.
Do you know any package with it?
Best regards,
Rui
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.o
I will also post the above to the sig mixed models forum now.
Thanks.
--
View this message in context:
http://r.789695.n4.nabble.com/General-question-about-GLMM-and-heterogeneity-of-variance-tp4424429p4431107.html
Sent from the R help mailing list archive at Nabble.com.
__
Hello R people,
How can I compute the mean of the "Pulse_rate" column of the data frame or
matrix from the following character object called "str_got". It has 14
entries and each entry has 8 values, separated by commas. Please go thru
the following R commands to know how I tried to unstring and
Hi all,
I am new to R and have some trouble with exporting results from a non linear
squares object (.nls), would be very thankful if anyone could help me.
So what I'm doing is a Bass modelling of some data. The result is stored in
the object "Bass.nls". I want to export a matrix with the three
Ah yes, I can open it with Notepad...it reads the following:
* installing *source* package 'QRMlib' ...
** Creating default NAMESPACE file
** libs
ERROR: compilation failed for package 'QRMlib'
* removing 'C:/PROGRA~1/R/R-214~1.1/bin/QRMLIB~1.RCH/QRMlib'
--
View this message in context:
http:/
Le mardi 28 février 2012 à 02:48 -0800, sazzle a écrit :
> Hi, I'm wondering if you can help me, this is a really simple query but I
> keep getting confused. I have run a GLM to see how boldness varies over
> time following a particular treatment. The results are as follows...
>
> Call: glm(for
Sorry, I was not particularly clear.
I ran my data through a GLM (the response variable is a proportion, and I
ignored the random effects for the purposes of data exploration), and
plotted the residuals against each of my predictor variables (some of which
are continuous, some categorical). The h
On Tue, Feb 28, 2012 at 11:42:32AM -0800, helin_susam wrote:
> Dear Petr Savicky,
>
> Actually, this is based on jackknife after bootstrap algorithm. In summary,
>
> I have a data set, and I want to compute some values by using this
> algorithm.
>
> Firstly, using bootstrap, I create some bootst
On 29-02-2012, at 07:03, lidaky wrote:
> Hi,
>
> today i wrote a function in R of the type:
>
> index.refraction <- function(Temp,Press, RH, CO2)
>
> When i try to plug a negative number in Temp, i got this type of error:
>
> "
> n <- index.refraction(Temp= -40,100,80,CO2)
> Messages d'avis :
101 - 167 of 167 matches
Mail list logo
