Thank you very much,
your proposal is one practical way to check for significant features.
I tried to check for all combination in a loop, but unfortunately there is a
problem with NA values.
Maybe anybody has an idea.
This is my expansion of the former code:
UPDATE
This line of code will produce what i desired, i will check if the tuning of
the svm works as i planed and post the solution asap
l - apply(head(namen, -1), 1, function(x)
reformulate(paste(na.omit(x), collapse = +), response =
type))
l[[1]]
Dear colleagues,
For the past two weeks we have been struggling to create a proper image
with stable pixels, height width from R for various screen resolutions.
We are trying to generate a wmf image with fixed pixels, fixed height
fixed width. But the problem we are facing is that when the
I have a data which contain some NA value in their elements.
What I want to do is to **perform clustering without removing rows**
where the NA is present.
I understand that `gower` distance measure in `daisy` allow such situation.
But why my code below doesn't work?
__BEGIN__
# plot heat map
ID
a_t1a_t2b_t1b_t2
CACCCGTAGAACCGACCTTGCG_mmu-miR-99b-5p15781941234810941
CACCCGTAGAACCGACCTTGC_mmu-miR-99b-5p4424265643839
CACCCGTAGAACCGACCTTG_mmu-miR-99b-5p544366253
CCGTAGAACCGACCTTGCG_mmu-miR-99b-5p263333157
I think you start by doing your homework:
1. Read An Inroduction to R (ships with R) or other R online
tutorial. There are many good ones.
2. Use R's Help system:
?aov
?lm
?anova
there will be relevant links in these docs that you should follow,
especially to the use of formulas for model
Dear All,
I'm trying using the survpack to apply support vector machines on survival
analysis, but I find that it's very slow. I use a data frame with 1082 rows
and 8 columns but it seems to run forever... Does anyone have any insight
or suggestion to this or have better knowledge of another R
Dear All,
I want to generate survival curve with cox model but I want to estimate the
coefficients using glmnet. However, I also want to include a strata() term
in the model. Could anyone please tell me how to have this strata() effect
in the model in glmnet? I tried converting a formula with
On 07/12/2013 12:46, Venkat Karthik wrote:
Dear colleagues,
For the past two weeks we have been struggling to create a proper image
with stable pixels, height width from R for various screen resolutions.
You cannot do that: it is a function of the format and how Microsoft's
GDI works.
We
Hi,
According to daisy function from cluster documentation, it can compute
dissimilarity when NA (missing) value(s) is present.
http://stat.ethz.ch/R-manual/R-devel/library/cluster/html/daisy.html
But why when I tried this code
library(cluster)
x - c(1.115,NA,NA,0.971,NA)
y -
10 matches
Mail list logo