Dear list,
since I have upgraded openOffice to version 3.2 I have some
trouble to open very simple ODT files generated by odfweave:
the file is apparently corrupted (but recovery is fine).
I have observed this under windows and mac OS 10.4.11 with
R 2.10.0, odfWeave_0.7.11, XML_2.6-0,
At 15:57 -0400 11/05/10, Max Kuhn wrote:
Problems have been reported, such as:
https://stat.ethz.ch/pipermail/r-help/2010-May/237577.html
but I have not reproduced them.
For me it works fine with the results in the above link and with:
sessionInfo()
R version 2.10.0 RC (2009-10-18
Dear all,
I'm resurrecting this old post (about 6 monts old, reproduced thereafter)
because I have struggled against the same problem and found a solution
so that I found it was worth posting for the record.
The simple fix when you want to use odfWeave with 7-ZIP as a
compressing/decompressing
stripchart.formula() works for me with your modification to
stripchart.default().
Great!
But you don't need the 'bordered' pch for that.
Indeed, but this may improve lisibility:
#
n - 500
x - rnorm(n)
y - rnorm(n)
fac1 - rep(c(male, female), n)
fac2 - rep(c(blue, red), each = n/2)
Dear all,
consider:
###
x - round(rnorm(50))
stripchart(x, pch = 21, col = black, bg = pink, method = jitter)
points(0.5, 1, pch = 21, col = black, bg = pink, cex = 2)
###
Under R 2.9.0 the points produced by stripchart are not colored,
while points() gives the desidered output (magnified
I think that it's a good idea, although I have rarely made use
of pch 20.
This reminds me to pass on a very belated thank-you to the
developer(s) who implemented the formula version for stripchart,
which I had promised to do myself quite a long time ago.
Thanks, folks!
Peter Ehlers
Hi Peter,
Dear Alessia,
I am very new to R and wanted to know if there is a package that, given very
long nucleotide sequences, searches and identifies short (7-10nt) motifs.. I
would like to look for enrichment of certain motifs in genomic sequences.
I tried using MEME (not an R package, I know),
Kim,
Is is what you want?
tmp - readLines(textConnection(
TGCATACACCGACAACATCCTCGACGACTACACCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
Dear Anne-Marie,
we had a similar problem to handle the LaTeX book that ships with the
seqinr package (http://pbil.univ-lyon1.fr/software/seqinr/seqinr_1_1-5.pdf).
Here is basically the approach we have used:
o Each book chapter is written first as a LaTeX article produced by Sweaving
its
Hmmm, i've downloaded your pdf, and it is clearly ugly at 400%.
I'm talking about the Rlogo.pdf file. E.g. i'm not sure that
it would look good on an A0 poster.
Gabor,
you're right, I didn't think about the A0 poster case. You will
find here a vectorized version of the Rlogo in eps, pdf and
svg
Dear Mag. Ferri Leberl,
I'm using something like:
--- tex.tex ---
\documentclass{article}
\usepackage{graphicx}
\usepackage{fancyvrb}
\newcommand{\Rlogo}{\protect\includegraphics[height=1.8ex,keepaspectratio]{Rlogo.pdf}}
\newcommand{\myinput}[1]
Gabor,
this is nice, but
1) the logo is a bitmap, it is ugly if you resize it
Sure, it's a bitmap, but the naked eye resolution is only
100 $\mu$m so that a vectorized solution is overkilling
in most common situations IMHO. I have to zoom by a factor
1200% to see some pixellization problems
Dear all,
thanks for your suggestions. I like the idea of including directly
the LaTeX file corresponding to the targeted topic, however, my
understanding from the reading of ?help is that these LaTeX files
are not always available, depending on the build of R.
I found a solution that works well
On Mon, 28 Jan 2008 13:38:51 -0600, Roger Koenker wrote:
Howard Wainer (Graphical Discovery, PUP, 2005, p 20) gives
this dubious honor to Playfair (1759- 1823). Nightingale (1820-
1910) was far too enlightened for this sort of thing, see for example
her letter to Galton about
Dear useRs,
by a circular diagram representation I mean what you will get by entering
this at your R promt:
pie(1:5)
Nice to have R as a lingua franca :-)
The folowing quote is from page 360 in this very interesting paper:
@article{SpenceI2005,
title = {No Humble Pie: The
Nice. Two minor points:
- the illustration for Danish has a cake which is speaking Polish
- Stastistical (on the ISI page)
Ooops! I have changed the picture and fixed the typo, Thanks.
--
Jean R. Lobry([EMAIL PROTECTED])
Laboratoire BBE-CNRS-UMR-5558, Univ. C. Bernard - LYON
Dear useRs,
by a circular diagram representation I mean what you will get by entering
this at your R promt:
pie(1:5)
Nice to have R as a lingua franca :-)
The folowing quote is from page 360 in this very interesting paper:
@article{SpenceI2005,
title = {No Humble Pie: The Origins and
Hi there,
I am looking for R-packages that can help me visualize properties on
nucleotide sequences. I want to display sequences in the 1-100K base range
as lines and plot features above and below those lines.
Any ideas would be welcome.
Thanks,
Bernd
Hi Bernd,
not sure to understand what
Dear Shubha,
May be a trivial question, but struggling to find a solution...
v=data.frame(a=c(1,234,2,345,5,567))
v
a
11,234
22,345
35,567
I need a column 'b', which is just the addition of column 'a' with 5.
How do I do it? And, entries in column 'a' are
Dear Julien,
Hi,
I am trying to use ggplot2 graphics with Sweave, but I got problems
with transparency support when generating pdf figures, even if I
specify a ?pdf.version? argument in Sweave options.
[...snip...]
I wanted to help because I'm interested by the exploitation
of the
20 matches
Mail list logo