[R] Convert CSV file to FASTA

2011-08-31 Thread anyone
Hi there, I have large excel files which I can save as CSV files. Each excel file contains two columns. One contains the chromosome number and the second contains a DNA sequence. I need to convert this into a fasta file that looks like this chromosomenumber CGTCGAGCGTCGAGCGGAGCG Can

Re: [R] Convert CSV file to FASTA

2011-08-31 Thread Mike Marchywka
Date: Wed, 31 Aug 2011 01:36:51 -0700 From: oliviacree...@gmail.com To: r-help@r-project.org Subject: [R] Convert CSV file to FASTA Hi there, I have large excel files which I can save as CSV files. Each excel file contains two

Re: [R] Convert CSV file to FASTA

2011-08-31 Thread Martin Morgan
On 08/31/2011 01:36 AM, anyone wrote: Hi there, I have large excel files which I can save as CSV files. Each excel file contains two columns. One contains the chromosome number and the second contains a DNA sequence. I need to convert this into a fasta file that looks like this