Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
chromosomenumber
CGTCGAGCGTCGAGCGGAGCG
Can
Date: Wed, 31 Aug 2011 01:36:51 -0700
From: oliviacree...@gmail.com
To: r-help@r-project.org
Subject: [R] Convert CSV file to FASTA
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two
On 08/31/2011 01:36 AM, anyone wrote:
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
3 matches
Mail list logo