Re: [R] codon usage bias

2012-02-29 Thread R. Michael Weylandt
This question sounds more suited for the Bioconductor list which focuses on R tools for genetic/bioinformatic computation. It's an active and very friendly list and I think one doesn't have to subscribe to post (but doing so certainly isn't a bad idea). Michael On Feb 29, 2012, at 9:55 AM, aoi

[R] codon usage bias

2012-02-29 Thread aoife
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccagata"