On 30/06/06, ryan luna <[EMAIL PROTECTED]> wrote:
> def number_anwser(self):
> guess = self.guess_ent.get()
> guess = int(guess)
> response = ""
> tries = 1
>
> if (guess < the_number):
> response += "Higher"
> tries += 1
>
Hey everyone, im just learning to use Tkinter, and im trynig to write a"Guess my number" game program in widget forum but im having some problems,First heres the code im using,Button(self, text = "Sumit", command = self.number_anwser ).grid(row = 4, column =
Evan Klitzke wrote:
> Hi, I just started picking up python yesterday, and have already come
> across something that has me stumped. I want some code that does
> this:
>
> a = foo(a)
> b = foo(b)
> c = foo(c)
>
> So I try to do this with a for loop, like so:
>
> for i in [a, b, c]:
>i = foo(i)
Evan Klitzke wrote:
> Hi, I just started picking up python yesterday, and have already come
> across something that has me stumped. I want some code that does
> this:
>
> a = foo(a)
> b = foo(b)
> c = foo(c)
>
> So I try to do this with a for loop, like so:
>
> for i in [a, b, c]:
>i = foo(i)
Hi, I just started picking up python yesterday, and have already come
across something that has me stumped. I want some code that does
this:
a = foo(a)
b = foo(b)
c = foo(c)
So I try to do this with a for loop, like so:
for i in [a, b, c]:
i = foo(i)
print i # make sure that it worked
> how to use classes and functions in python
> thanks
Most of the online tutorials, including mine, will have a section on
OOP.
Try reading one and if you have specific questions come back here
and we will try to answer them.
Alan Gauld
Author of the Learn to Program web site
http://www.freene
On Thu, 29 Jun 2006, Apparao Anakapalli wrote:
> pattern = 'ATTTA'
>
> I want to find the pattern in the sequence and count.
>
> For instance in 'a' there are two 'ATTTA's.
use re.findall:
>>> import re
>>> pat = "ATTTA"
>>> rexp=re.compile(pat)
>>> a = "TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGT
On Thu, Jun 29, 2006 at 01:06:54PM -0700, Matthew White wrote:
> Hello Appu,
>
> You can use the count() method to find the number of occurances of a
> substring within a string:
>
> >>> a = 'TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTA'
> >>> a.count('ATTTA')
> 2
>
And, if you need to search
Hello Appu,
You can use the count() method to find the number of occurances of a
substring within a string:
>>> a = 'TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTA'
>>> a.count('ATTTA')
2
-mtw
On Thu, Jun 29, 2006 at 12:45:06PM -0700, Apparao Anakapalli ([EMAIL
PROTECTED]) wrote:
> hello all:
hello all:
I have a question and I do not know how I can work it
out.
I have a file of sequences
>a
TCCCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACATTTA'
>b
CCTGCGGCGCATGAGTGACTGGCGTATTTAGCCCGTCACAATTTAA'
(10 K)
pattern = 'ATTTA'
I want to find the pattern in the sequence and count.
For ins
how to use classes and functions in python
thanks
__
Do You Yahoo!?
Tired of spam? Yahoo! Mail has the best spam protection around
http://mail.yahoo.com
___
Tutor maillist - Tutor@python.org
http://ma
>> Why isn't this function in the os module with the other file commands?
>
> I don't know why they are broken up in this way. The glob module also
> has some file access commands.
For the most part, the 'os' module follows the interface functions that C
provides to access the operating system.
On Thu, 29 Jun 2006, Tino Dai wrote:
> Between the producer and consumer threads, does the consumer end of the
> queue sit there and wait for something to come down the queue...
Yes. The following call:
workunit = self.inQ.get(True)
means, try to take something off the queue, and if the que
Hi, I know that this is not question for this tutor, but someone please help. I tried everething but just not working. I contact Deitel, but they don't know I have Python multimedia cyber classroom cd with book Python how to program. When I run My cyberclassroom I get this error: A
Okay, I was bored tonight, so I cooked up an illustration.Thanks for that!
Here's an example with five stages. Stage 1 takes a string and fills aninput queue with a series of letters from the string. Stages 2-4 do just
take a letter off its input queue and move it to its output queue. Stage5 ta
On Wed, 28 Jun 2006, Terry Carroll wrote:
> On Wed, 28 Jun 2006, Tino Dai wrote:
>
> > Ok, I think I'm going to back up and explain what I'm am heading towards.
> > I'm working on an app that fire off a bunch of threads. Each one of these
> > threads in connected via queues to another thread in a
> From: "John Fouhy" <[EMAIL PROTECTED]>
>
> On 29/06/06, Kent Johnson <[EMAIL PROTECTED]> wrote:
> > See shutil.copyfile()
>
> Why isn't this function in the os module with the other file commands?
I don't know why they are broken up in this way. The glob module also has some
file access comma
17 matches
Mail list logo
