Public bug reported: ncbi-blast+ remote executions throw ugly 'Critical' warnings on focal amd64:
$ blastn -query test.fa -db nt -remote Critical: [blastn] External MBEDTLS version mismatch: 2.16.2 headers vs. 2.16.3 runtime [rest of the response trimmed] where test.fa is any DNA FASTA file, for example: >test AAAAAAAAACCCCCCCAAAAAGGGGTTTTT The execution and output of the aforementioned call seems otherwise normal despite the 'Critical' message. From the buildlog on amd64 I see that ncbi-blast+ is built against libmbedtls12/2.16.2 while it is run with libmbedtls12/2.16.4. I believe rebuilding with libmbedtls12/2.16.4 would solve the issue. ** Affects: ncbi-blast+ (Ubuntu) Importance: Undecided Status: New ** Tags: focal -- You received this bug notification because you are a member of Ubuntu Bugs, which is subscribed to Ubuntu. https://bugs.launchpad.net/bugs/1966683 Title: Rebuild with libmbedtls12/2.16.4 on focal To manage notifications about this bug go to: https://bugs.launchpad.net/ubuntu/+source/ncbi-blast+/+bug/1966683/+subscriptions -- ubuntu-bugs mailing list ubuntu-bugs@lists.ubuntu.com https://lists.ubuntu.com/mailman/listinfo/ubuntu-bugs