On 21/03/2014 09:31, Mustafa Musameh wrote:
Please help. I have been search the internet to understand how to write a 
simple program/script with python, and I did not do anything.
I have a file that look like this
ID 1
agtcgtacgt…
ID 2
attttaaaaggggcccttcc
.
.
.
in other words, it contains several IDs each one has a sequence of 'acgt' 
letters
I need to write a script in python where the output will be, for example, like 
this
ID 1
a = 10%, c = 40%,  g=40%, t = 10%
ID 2
a = 15%, c = 35%,  g=35%, t = 15%
.
.
.
(i mean the first line is the ID and the second line is the frequency of each 
letter )
How I can tell python to print the first line as it is and count characters 
starting from the second line till the beginning of the next '>' and so on

Please help

Welcome :)

Start here http://docs.python.org/3/tutorial/index.html and then come back with specific questions about any problems that you may encounter.


--
My fellow Pythonistas, ask not what our language can do for you, ask what you can do for our language.

Mark Lawrence

---
This email is free from viruses and malware because avast! Antivirus protection 
is active.
http://www.avast.com


_______________________________________________
Tutor maillist  -  [email protected]
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor

Reply via email to