riaz tabassum wrote:
> Sir i have a problem to solve to python code. I have attached the pic of
> problem statement.
This is a text-only mailing list. Please describe the problem you are trying
to solve in plain English. Thank you.
> code which i write is pasted here.
> "def Skew(Genome):
> skew = {}
> #initializing the dictionary
> skew[0]=0#initializing the dictionary
>
> for i in range(len(Genome)):
> if i==0:
>
> if Genome[i]=='G':
>
> skew[i]=skew[i]+1
> elif Genome[i]=='C':
>
> skew[i]=skew[i]-1
> else:
>
> skew[i]=skew[i]
>
>
> elif Genome[i]=='G':
>
> skew[i]=skew[i-1]+1
>
>
> elif Genome[i]=='C':
> skew[i]=skew[i-1]-1
>
> else:
> skew[i]=skew[i-1]
Is the part above provided by your teacher? Then it's pobably correct and
you can concentrate on
> # your code here
> return skew
Hint: the order of the items in a dict is undefined and you may even get
different output when you run the same script twice.
As a simple way around this you can sort the keys and then create a list by
looking up the corresponding values.
Did you learn about list comprehensions? The sorted() function? Both may be
useful.
> Genome="CGCAGATGTTTGCACGACTGTGACAC"
> print Skew(Genome).values()
That line should probably be
print Skew(Genome)
as any data preprocessing is best done inside the Skew() function.
> #Sample Output:
> #0', '-1', '0', '-1', '-1', '0', '0', '0',
> #'1', '1', '1', '1', '2', '1', '1', '0', '1', '1',
> #'0', '0', '1', '1', '2', '2', '1', '1', '0'
> "
>
>
> But i am facing the problem that i could not include the first index
> which is initialized to zero in my answer.
>
>
> the error is shown as
>
> Failed te #2.
>
> Test Dataset:
> CGCAGATGTTTGCACGACTGTGACAC
>
> Your output:
> ['-1', '0', '-1', '-1', '0', '0', '0', '1', '1', '1', '1', '2', '1',
> '1', '0', '1', '1', '0', '0', '1', '1', '2', '2', '1', '1', '0']
>
> Correct output:
>
> ['0', '-1', '0', '-1', '-1', '0', '0', '0', '1', '1', '1', '1', '2', '1',
> '1', '0', '1', '1', '0', '0', '1', '1', '2', '2', '1', '1', '0']
> _______________________________________________
> Tutor maillist - Tutor@python.org
> To unsubscribe or change subscription options:
> https://mail.python.org/mailman/listinfo/tutor
_______________________________________________
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
