My complete code:
from sys import argv
from string import find, split, strip
import os
import zipfile
def import_files():
items = []
'''stub for import'''
form = form_factory(Field('seqzip', 'upload', label="Sequence Files
(.zip)", requires=IS_NOT_EMPTY(), uploadfield=False))
if form.accepts(request.vars):
zf = zipfile.ZipFile(request.vars.seqzip.file)
for name in zf.namelist():
filename = name.split('/')[-1]
file_raw = zf.read(name)
jsoligo = ''.join(split(''.join(file_raw)))[::-1]
rev =(jsoligo[find(jsoligo,'/')+2:find(jsoligo,';')][::-1])
db.plugin_seq.insert(filename=filename,raw_seq=file_raw,processed_seq=rev)
if db(db.plugin_seq.filename==filename).count():
rec =
db(db.plugin_seq.filename==filename).select().first()
rec.update_record(raw_seq=file_raw,processed_seq=rev)
db.commit()
return ('<br>'.join(zf.namelist()))
return form
def records():
values = [r.processed_seq for r in
db().select(db.plugin_seq.processed_seq)]
return values
def index():
return dict()
My complete file path:
home/praveen/web2py/web2py/PCGENE_Format/N77CDR1K.ATD is displayed in out
put.
****************It is sample of my
output**************************************+
GCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCCACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTC|CGENE_Forma|CGENE_Forma|CGENE_Forma|CGENE_Forma|CGENE_Forma||CGENE_Forma|CGENE_Forma|CGENE_Forma|CGENE_Formrma|rimer_forma|rimer_forma||rimer_forma|rimer_forma|rimer_forma|rimer_forma|rimer_forma|rimer_forma||GCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCTTTAGCTGTGGAAGATTTCTTGTCATCGAATATACATCATATGTAACAATTCTTTTTCTCAATGTTTATGCGTGACCCAAACATA
eb2py/PCGENE_Format/NGFP_TRK.1/home/praveen/web2py/web2py/PCGENE_Format/NP7C1TRK.1D/home/praveen/web2py/web2py/PCGENE_Format/NPKGTS1/home/praveen/web2py/web2p']||['home/praveen/web2py/web2py/sampleforma']||['home/praveen/web2py/web2py/sampleforma',
The contents of the file producing the values is the sequence like
GCTTCCGGCTCTTTAGCTGTGGAAGATTTCTTGTCATCGAATATACATCATATGTAACAATTCTTTTTCTCAATGTTTATGCGTGACCCAAACATA,
but along this seq is followed by
|CGENE_Forma|CGENE_Forma|CGENE_Forma|CGENE_Forma|CGENE_Forma||CGENE_Forma|CGENEimer_forma|rimer_forma|rimer_forma||GCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGCACCCCA
eb2py/PCGENE_Format/NGFP_TRK.1/home/praveen/web2py/web2py/PCGENE_Format/NP7C1TRK.1D/home/praveen/web2py/web2py/PCGENE_Format/NPKGTS1/home/praveen/web2py/web2p'
which I don't want to.
On Sun, Jun 17, 2012 at 4:30 PM, Anthony <abasta...@gmail.com> wrote:
> What's your current complete code for generating the values and inserting
> them in the db? What's an example of a complete file path and name within
> the zip file as well as the contents of that file that is producing a value
> like the ones below?
>
> ya its in subfolder but with ' filename = name.split('/')[-1]' I am able
>> to read the file names and with 'file_raw = zf.read(name) ' i am able to
>> read the sequence in the file .But the other problem with table is not
>> solved I am still getting unwanted information like file path for example
>> like "web2py/PCGENE_Format/NGFP_**TRK.1/home/praveen/web2py/**
>> web2py/PCGENE_Format/NP7C1TRK.**1D/home/praveen/web2py/web2py/**
>> PCGENE_Format/NPKGTS1/home/**praveen/web2py/web2p']||['**
>> home/praveen/web2py/web2py/**sampleforma']||['home/praveen/**
>> web2py/web2py/sampleforma'....**...."
>> with the sequence information .I think that the problem in the way I am
>> inserting the records .I have used
>> db.plugin_seq.insert(filename=**filename,raw_seq=file_raw,**
>> processed_seq=rev)
>> if db(db.plugin_seq.filename==**filename).count():
>>
>> rec =
>> db(db.plugin_seq.filename==**filename).select().first()
>>
>> rec.update_record(raw_seq=**
>> file_raw,processed_seq=rev)
>> db.commit()
>> to insert and update record and to extract the processed sequence I am
>> using
>> def records():
>> values = [r.processed_seq for r in db().select(db.plugin_seq.**
>> processed_seq)]
>> return values
>>
>>
>>
>> I have tried that by removing the subfolder but its giving an error
>>>> import zipfile
>>>> def zipfolder():
>>>> zf = zipfile.ZipFile('/home/**praveen**/job_files/seq_data/**
>>>> PCGENE_**Format.zip')
>>>> fil = zf.open('/home/praveen/job_**fil**es/seq_data/PCGENE_Format.
>>>> **zip/**NPKGTS1')
>>>> print fil
>>>> error:
>>>> There is no item named '/home/praveen/job_files/seq_**d**
>>>> ata/PCGENE_Format.zip/**NPKGTS1' in the archive"
>>>>
>>>
>>> No, I was asking whether there were any subfolders inside the zip file
>>> itself (you can zip an entire directory structure). If so, for files that
>>> are inside subfolders *within* the zip file, I would think you would
>>> have to refer to the entire path, not just the filename.
>>>
>>> Anthony
>>>
>>
>>
