Hi Libing. I'm afraid that aroma.affymetrix will not work on TXT files. I suggest you check out the following functions in the 'affxparser' package:
?readCel (just so you know what is stored) ?createCel (to create the file) ?updateCel (to store intensities in the file) Once you figure out the inputs for those functions It should be pretty straightforward to take your simulated data and push it into a CEL file. Hope that helps. Cheers, Mark On 16-Dec-09, at 5:14 AM, Libing Wang wrote: > Hi Mark, > > Thanks a lot for your help! > Now I want to work with some simulated data with aroma to calculate > summarized intensities of probesets. The problem is that I only have > a txt file with original probe signal intensities but aroma could be > only fed by cel files. Is it possible let aroma work with txt files? > If not, are there any ways to construct cel files from txt files? > Thanks! /Libing > > On Fri, Nov 6, 2009 at 6:35 AM, Mark Robinson > <mrobin...@wehi.edu.au> wrote: > Hi Libing. > > Are you after the probe IDs from the probe.tab file? For example: > > Probe ID Probe Set ID probe x probe y assembly > seqname start stop > strand probe sequence target strandedness category > 4485910 2315252 789 1752 build-34/hg16 chr1 407616 > 407640 + > GTAATGCTTGCCACATAGAGCACAG Sense main > 2412400 2315252 879 942 build-34/hg16 chr1 408027 > 408051 + > AAGCTGTCCAACACATTAGGGCCAC Sense main > 4260180 2315252 339 1664 build-34/hg16 chr1 408088 > 408112 + > GAACTGCAATCTGTAGGTGTCGGTA Sense main > 5750312 2315252 551 2246 build-34/hg16 chr1 408300 > 408324 + > TCCATCTGTGAATTAGGGTGTGGCC Sense main > 2959753 2315253 392 1156 build-34/hg16 chr1 408431 > 408455 + > AGATCCTCTTGTAAATCACTAGCTG Sense main > 294823 2315253 422 115 build-34/hg16 chr1 408433 > 408457 + > TGAGATCCTCTTGTAAATCACTAGC Sense main > 5504333 2315253 332 2150 build-34/hg16 chr1 408434 > 408458 + > ATGAGATCCTCTTGTAAATCACTAG Sense main > 1224013 2315253 332 478 build-34/hg16 chr1 408436 > 408460 + > TTATGAGATCCTCTTGTAAATCACT Sense main > > > If so, you could make a lookup table from that and match them to the > info in your CDF file. For example: > > > cdf <- AffymetrixCdfFile$byChipType("HuEx-1_0-st-v2", > tag="coreR3,A20071112,EP") > > u <- readUnits(cdf, units=1, readBases=FALSE, readExpos=FALSE, > readType=FALSE, readDirection=FALSE) > > u > $`2315251` > $`2315251`$groups > $`2315251`$groups$`2315252` > $`2315251`$groups$`2315252`$x > [1] 789 339 879 551 > > $`2315251`$groups$`2315252`$y > [1] 1752 1664 942 2246 > > > $`2315251`$groups$`2315253` > $`2315251`$groups$`2315253`$x > [1] 332 422 392 332 > > $`2315251`$groups$`2315253`$y > [1] 2150 115 1156 478 > > ... so if you read your BG adjusted intensities into a matrix, you > could annotate each row with the probe ID. > > Is that what you had in mind? If so, hope that gets you started. > > Cheers, > Mark > > > > On 3-Nov-09, at 6:50 AM, Libing Wang wrote: > > > Hi Mark, > > > > Thanks for your help so far! Now I have a quick question for you. Is > > there any ways to get the probe ID for background corrected probe > > intensities? If I have finish the following steps: > > > > bc <- RmaBackgroundCorrection(cs, tag="core,A20071112,EP") > > csBC <- process(bc, verbose=verbose) > > > > Thanks! > > > > Libing > > > > On Wed, Jun 17, 2009 at 6:18 PM, Mark Robinson > > <mrobin...@wehi.edu.au> wrote: > > > > > > Hi Libing. > > > > Doesn't 'addNames=TRUE' already do this for you? > > > > > > > fs1 <- extractDataFrame(fs, units=1:2, addNames=TRUE) > > > head(fs1[,1:6]) > > unitName groupName unit group cell huex_wta_breast_A > > 1 2315251 2315252 1 1 1 1.1150999 > > 2 2315251 2315253 1 2 2 0.9551846 > > 3 2315373 2315374 2 1 3 1.5354252 > > 4 2315373 2315375 2 2 4 0.6288152 > > 5 2315373 2315376 2 3 5 1.5658265 > > 6 2315373 2315377 2 4 6 1.2131032 > > > fs2 <- extractDataFrame(fs, units=1:2, addNames=FALSE) > > > head(fs2[,1:6]) > > unit group cell huex_wta_breast_A huex_wta_breast_B > > huex_wta_breast_C > > 1 1 1 1 1.1150999 0.8552212 > > 0.9177643 > > 2 1 2 2 0.9551846 1.1747438 > > 0.8580346 > > 3 2 1 3 1.5354252 1.0427089 > > 1.6461661 > > 4 2 2 4 0.6288152 0.7053325 > > 0.6999596 > > 5 2 3 5 1.5658265 1.0576524 > > 1.1404822 > > 6 2 4 6 1.2131032 1.0494679 > > 0.7729633 > > > > If not, please send your entire script and the output of > > sessionInfo(). > > > > Cheers, > > Mark > > > > > > On 18/06/2009, at 1:02 AM, Libing Wang wrote: > > > > > Hi Mark, > > > > > > I am wondering if it is possible to get the actual unit > > > id(transcript cluster id) and group id(probeset id) for each firma > > > score instead of artificial number from 1 to whatever in the firma > > > score data frame. > > > > > > Thanks, > > > > > > Libing > > > > > > On Sat, Apr 11, 2009 at 5:48 PM, Mark Robinson > > > <mrobin...@wehi.edu.au> wrote: > > > > > > Hi Libing. > > > > > > As the error message suggests, there are no degrees of freedom for > > the > > > fit, meaning you have no replicates. It appears you only have 2 > > total > > > samples, one for each group. You wouldn't be able to use limma to > > do > > > differential expression on any experiment with only 2 1-channel > > chips. > > > > > > If that is all the data you have, perhaps you are best off looking > > for > > > large (positive or negative) values of the difference: > > > > > > fsdf <- extractDataFrame(fs, addNames=TRUE) > > > fsdf[,6:ncol(fsdf)] <- log2(fsdf[,6:ncol(fsdf)]) > > > > > > fsdf[,7] - fsdf[,6] # B-A, assuming you've already taken logs > > > > > > Cheers, > > > mark > > > > > > > > > > > > > Hi Mark, > > > > > > > > I am trying to find differences of FIRMA scores between two > chips > > > and > > > > don't > > > > know what's wrong: > > > > > > > >> cls <- c("A","B") > > > >> mm <- model.matrix(~cls) > > > > Warning message: > > > > In model.matrix.default(~cls) : variable 'cls' converted to a > > factor > > > >> fit <- lmFit(fsdf[,6:7], mm) > > > > Warning message: > > > > In lmFit(fsdf[, 6:7], mm) : > > > > Some coefficients not estimable: coefficient interpretation may > > > vary. > > > >> fit <- eBayes(fit) > > > > Error in ebayes(fit = fit, proportion = proportion, > > stdev.coef.lim = > > > > stdev.coef.lim) : > > > > No residual degrees of freedom in linear model fits > > > > > > > > Thanks, > > > > > > > > Libing > > > > > > > > On Tue, Apr 7, 2009 at 5:54 PM, Mark Robinson > > > <mrobin...@wehi.edu.au> > > > > wrote: > > > > > > > >> > > > >> Hi Libing. > > > >> > > > >> limma has quite an extensive user manual. See link to it: > > > >> http://www.bioconductor.org/packages/release/bioc/html/limma.html > > > >> > > > >> Your response still puzzles me. You say your wording should've > > > been > > > >> 'splicing' not 'expression', but then you go on to say that you > > > want > > > >> to do differential *expression* with limma. > > > >> > > > >> However, note that you can use limma on FIRMA scores as well, > as > > > >> discussed previously. If that is what you are interested in, > you > > > >> might check the following thread: > > > >> > > > >> http://groups.google.com/group/aroma-affymetrix/browse_thread/thread/36d8c59d742fc503/ > > > >> > > > >> If you give a more detailed description of what it is you are > > > doing or > > > >> want to do, I might be better able to help. > > > >> > > > >> Cheers, > > > >> Mark > > > >> > > > >> On 08/04/2009, at 8:10 AM, Libing Wang wrote: > > > >> > > > >> > Hi Mark, > > > >> > > > > >> > Thank you for your reply! > > > >> > Sorry for my wrong wording! It should be "splicing" not > > > "expression". > > > >> > > > > >> > ... then you can use log2 of the chip effects here for an > > > analysis of > > > >> > differential expression with an appropriate design matrix > with > > > limma. > > > >> > Is that what you are after? > > > >> > > > > >> > Yes, this is what I want. I think I need process Affymetrix > > > probeset > > > >> > file to correlate probesets and transcripts, then use limma > > to do > > > >> > the analysis. I am pretty new to limma, do you have any > > > suggestions? > > > >> > > > > >> > Thanks, > > > >> > > > > >> > Libing > > > >> > > > > >> > On Tue, Apr 7, 2009 at 4:35 PM, Mark Robinson > > > >> > <mrobin...@wehi.edu.au> wrote: > > > >> > > > > >> > Hi Libing. > > > >> > > > > >> > > > > >> > On 08/04/2009, at 1:42 AM, Libing Wang wrote: > > > >> > > > > >> > > Hi, > > > >> > > > > > >> > > I am wondering if there is a way to compute a FIRMA score > for > > > each > > > >> > > transcript. Currently I only have FIRMA score for each > > > probeset or > > > >> > > group. I did as follows: > > > >> > > > > > >> > > 1. plmTr <- ExonRmaPlm(csN, mergeGroups=TRUE) > > > >> > > 2. fit(plmTr) > > > >> > > 3. firma<-FirmaModel(plmTr) > > > >> > > 4.fit(firma) > > > >> > > 5.fs<-getFirmaScores(firma) > > > >> > > > > >> > The short answer is that FIRMA scores are really a probeset- > > level > > > >> > statistic, not a gene/transcript-level statistic. This is > the > > > >> > recommended use of FIRMA. > > > >> > > > > >> > > > > >> > > Or with the FIRMA score of each probeset, find out which > > > >> > > transcripts are differentially expressed. > > > >> > > > > >> > This statement puzzles me. FIRMA is really going after > > > differential > > > >> > *splicing*, not differential expression. If you want > > > differential > > > >> > expression, you could do something like: > > > >> > > > > >> > ces <- getChipEffectSet(plmTr) > > > >> > gExprs <- extractDataFrame(ces, addNames=TRUE) > > > >> > > > > >> > ... then you can use log2 of the chip effects here for an > > > analysis of > > > >> > differential expression with an appropriate design matrix > with > > > limma. > > > >> > Is that what you are after? > > > >> > > > > >> > Alternatively, I am working on a gene-level score for > splicing, > > > just > > > >> > accepted for publication. This is meant to be applied to the > > > Affy > > > >> > Gene 1.0 ST arrays (or similar) but could be applied to the > > Exon > > > >> > arrays. This would give a gene-level scoring of splicing. > > > >> > > > > >> > Cheers, > > > >> > Mark > > > >> > > > > >> > > > > >> > > > > > >> > > Now I am trying to use limma to solve my problems and want > > some > > > >> > > directions if anyone knows. > > > >> > > > > > >> > > Thanks, > > > >> > > > > > >> > > Libing > > > >> > > > > > >> > > > > > > >> > > > > > >> > > > > >> > ------------------------------ > > > >> > Mark Robinson > > > >> > Epigenetics Laboratory, Garvan > > > >> > Bioinformatics Division, WEHI > > > >> > e: m.robin...@garvan.org.au > > > >> > e: mrobin...@wehi.edu.au > > > >> > p: +61 (0)3 9345 2628 > > > >> > f: +61 (0)3 9347 0852 > > > >> > ------------------------------ > > > >> > > > > >> > > > > >> > > > > >> > > > > >> > > > > >> > > > > >> > > > > > >> > > > > >> > > > >> ------------------------------ > > > >> Mark Robinson > > > >> Epigenetics Laboratory, Garvan > > > >> Bioinformatics Division, WEHI > > > >> e: m.robin...@garvan.org.au > > > >> e: mrobin...@wehi.edu.au > > > >> p: +61 (0)3 9345 2628 > > > >> f: +61 (0)3 9347 0852 > > > >> ------------------------------ > > > >> > > > >> > > > >> > > > >> > > > >> > > > >> > > > > >> > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > ------------------------------ > > Mark Robinson, PhD (Melb) > > Epigenetics Laboratory, Garvan > > Bioinformatics Division, WEHI > > e: m.robin...@garvan.org.au > > e: mrobin...@wehi.edu.au > > p: +61 (0)3 9345 2628 > > f: +61 (0)3 9347 0852 > > ------------------------------ > > > > > > > > > > > > > > --~--~---------~--~----~------------~-------~--~----~ > > When reporting problems on aroma.affymetrix, make sure 1) to run the > > latest version of the package, 2) to report the output of > > sessionInfo() and traceback(), and 3) to post a complete code > example. > > > > > > You received this message because you are subscribed to the Google > > Groups "aroma.affymetrix" group. > > To post to this group, send email to aroma-affymetrix@googlegroups.com > > To unsubscribe from this group, send email to > > aroma-affymetrix-unsubscr...@googlegroups.com > > For more options, visit this group at > > http://groups.google.com/group/aroma-affymetrix?hl=en > > -~----------~----~----~----~------~----~------~--~--- > > > > > > > > -- > > When reporting problems on aroma.affymetrix, make sure 1) to run the > > latest version of the package, 2) to report the output of > > sessionInfo() and traceback(), and 3) to post a complete code > example. > > > > > > You received this message because you are subscribed to the Google > > Groups "aroma.affymetrix" group. > > To post to this group, send email to aroma-affymetrix@googlegroups.com > > To unsubscribe from this group, send email to > > aroma-affymetrix-unsubscr...@googlegroups.com > > For more options, visit this group at > > http://groups.google.com/group/aroma-affymetrix?hl=en > > ------------------------------ > Mark Robinson, PhD (Melb) > Epigenetics Laboratory, Garvan > Bioinformatics Division, WEHI > e: m.robin...@garvan.org.au > e: mrobin...@wehi.edu.au > p: +61 (0)3 9345 2628 > f: +61 (0)3 9347 0852 > ------------------------------ > > > > > > -- > When reporting problems on aroma.affymetrix, make sure 1) to run the > latest version of the package, 2) to report the output of > sessionInfo() and traceback(), and 3) to post a complete code example. > > > You received this message because you are subscribed to the Google > Groups "aroma.affymetrix" group. > To post to this group, send email to aroma-affymetrix@googlegroups.com > To unsubscribe from this group, send email to > aroma-affymetrix-unsubscr...@googlegroups.com > For more options, visit this group at > http://groups.google.com/group/aroma-affymetrix?hl=en > > > -- > When reporting problems on aroma.affymetrix, make sure 1) to run the > latest version of the package, 2) to report the output of > sessionInfo() and traceback(), and 3) to post a complete code example. > > > You received this message because you are subscribed to the Google > Groups "aroma.affymetrix" group. > To post to this group, send email to aroma-affymetrix@googlegroups.com > To unsubscribe from this group, send email to > aroma-affymetrix-unsubscr...@googlegroups.com > For more options, visit this group at > http://groups.google.com/group/aroma-affymetrix?hl=en ------------------------------ Mark Robinson, PhD (Melb) Epigenetics Laboratory, Garvan Bioinformatics Division, WEHI e: m.robin...@garvan.org.au e: mrobin...@wehi.edu.au p: +61 (0)3 9345 2628 f: +61 (0)3 9347 0852 ------------------------------ ______________________________________________________________________ The information in this email is confidential and intended solely for the addressee. You must not disclose, forward, print or use it without the permission of the sender. ______________________________________________________________________ -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups "aroma.affymetrix" group. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe from this group, send email to aroma-affymetrix-unsubscr...@googlegroups.com For more options, visit this group at http://groups.google.com/group/aroma-affymetrix?hl=en