Dear Henrik, I am trying to run GcRMaBackgroundCorrection on HTA2.0 arrays. I built my own probeflat file, that I think that it is correct (but I may be wrong). After running this code I get the error
> bcgc <- GcRmaBackgroundCorrection(cs, tag=c("*","r11"),type="affinities"); > csBCgc <- process(bcgc,verbose=verbose,ram=40,safe =F); Loading required namespace: gcrma 20180804 14:58:26|Background correcting data set... 20180804 14:58:27| Background correcting data set... 20180804 14:58:33| Already background corrected for "optical" effects 20180804 14:58:33| Background correcting data set...done 20180804 14:58:38| Computing probe affinities (independent of data)... (More stuff) 20180804 14:58:45| Retrieving probe-sequence data... 20180804 14:58:45| Chip type (full): EP_HTA-2_0,r 20180804 14:58:45| Locating probe-tab file... 20180804 14:58:45| Chip type: EP_HTA-2_0 AffymetrixProbeTabFile: Name: EP_HTA-2_0 Tags: Full name: EP_HTA-2_0 Pathname: annotationData/chipTypes/EP_HTA-2_0/EP_HTA-2_0_probe_tab File size: 496.13 MiB (520234631 bytes) Number of data rows: NA Columns [6]: 'unitName', 'probeXPos', 'probeYPos', 'probeInterrogationPosition', 'probeSequence', 'targetStrandedness' Number of text lines: NA AffymetrixCdfFile: Path: annotationData/chipTypes/EP_HTA-2_0 Filename: EP_HTA-2_0,r.cdf File size: 140.18 MiB (146990714 bytes) Chip type: EP_HTA-2_0,r File format: v4 (binary; XDA) Dimension: 2572x2680 Number of cells: 6892960 Number of units: 97482 Cells per unit: 70.71 Number of QC units: 0 20180804 14:58:45| Locating probe-tab file...done 20180804 14:58:45| Validating probe-tab file against CDF... 20180804 14:58:46| Number of records read: 1 20180804 14:58:46| Data read: 'data.frame': 1 obs. of 1 variable: $ unitName: chr "TC01000001.hg_1" 20180804 14:58:46| Unit name: chr "TC01000001.hg_1" 20180804 14:58:46| Unit index: 1 probeXPos probeYPos probeSequence 1 84 1383 GGGGAAGGGCATGCCTGGCATCACC 20180804 14:58:46| (x,y): [1] 84 1383 20180804 14:58:46| Validating probe-tab file against CDF...done 20180804 14:58:46| Reading (x,y,sequence) data... 20180804 14:59:48| Reading (x,y,sequence) data...done 20180804 14:59:48| Validating (x,y) against CDF dimension... 20180804 14:59:48| CDF dimension: nbrOfRows nbrOfColumns 2572 2680 [2018-08-04 14:59:48] Exception: Detected probe x position out of range [0,2572]: annotationData/chipTypes/EP_HTA-2_0/EP_HTA-2_0_probe_tab at #08. getProbeSequenceData.AffymetrixCdfFile(this, safe = safe, verbose = verbose) - getProbeSequenceData.AffymetrixCdfFile() is in environment 'aroma.affymetrix' at #07. getProbeSequenceData(this, safe = safe, verbose = verbose) - getProbeSequenceData() is in environment 'aroma.affymetrix' at #06. computeAffinities.AffymetrixCdfFile(cdf, ..., verbose = less(verbose)) - computeAffinities.AffymetrixCdfFile() is in environment 'aroma.affymetrix' at #05. computeAffinities(cdf, ..., verbose = less(verbose)) - computeAffinities() is in environment 'aroma.affymetrix' at #04. calculateAffinities.GcRmaBackgroundCorrection(this, verbose = less(verbose)) - calculateAffinities.GcRmaBackgroundCorrection() is in environment 'aroma.affymetrix' at #03. calculateAffinities(this, verbose = less(verbose)) - calculateAffinities() is in environment 'aroma.affymetrix' at #02. process.GcRmaBackgroundCorrection(bcgc, verbose = verbose, ram = 40, safe = F) - process.GcRmaBackgroundCorrection() is in environment 'aroma.affymetrix' at #01. process(bcgc, verbose = verbose, ram = 40, safe = F) - process() is in environment 'aroma.core' Error: Detected probe x position out of range [0,2572]: annotationData/chipTypes/EP_HTA-2_0/EP_HTA-2_0_probe_tab 20180804 14:59:48| Validating (x,y) against CDF dimension...done 20180804 14:59:48| Retrieving probe-sequence data...done 20180804 14:59:48| Reading probe-sequence data...done 20180804 14:59:48| Computing GCRMA probe affinities...done 20180804 14:59:48| Computing probe affinities (independent of data)...done 20180804 14:59:48|Background correcting data set...done So it seems that there are "probe x position out of range [0,2572]"... My surprise came when I found that, indeed there are!!!! I checked (downloading the unsupported HTA-2_0-r1-exon_cdf.zip file from Affymetrix) after changing periods to commas that running cdfGFile <- file.path(Path, "HTA-2_0,r1,exon.cdf") system.time(df <- readCdfDataFrame(cdfGFile)) # Takes more than 30 minutes in my laptop... the df data.frame contains df$x out of the range 0:2572. In other words, it seems that the dimensions of the array are somehow switched and the sanity check of function getProbeSequenceData.AffymetrixCdfFile throws an error. In other words, in the official (albeit unsupported) cdf from Affy, there are probes with x position larger than 2572 and the dimensions seems to be switched. I was wondering if there is some type of bug: Affy arrays used to be square and therefore, the range for x and y was identical. Is there any way to circumvent this sanity check since everything seems to be working properly. Best regards, Angel Session Info: R version 3.4.2 (2017-09-28) Platform: x86_64-apple-darwin15.6.0 (64-bit) Running under: macOS High Sierra 10.13.5 Matrix products: default BLAS: /System/Library/Frameworks/Accelerate.framework/Versions/A/Frameworks/vecLib.framework/Versions/A/libBLAS.dylib LAPACK: /Library/Frameworks/R.framework/Versions/3.4/Resources/lib/libRlapack.dylib locale: [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] stats4 parallel stats graphics grDevices utils datasets methods base other attached packages: [1] future_1.8.0 limma_3.34.9 prodlim_2018.04.18 [4] RBGL_1.54.0 graph_1.56.0 Matrix_1.2-14 [7] stringr_1.3.1 MASS_7.3-50 igraph_1.2.1 [10] SGSeq_1.12.0 SummarizedExperiment_1.8.1 DelayedArray_0.4.1 [13] matrixStats_0.53.1 Rsamtools_1.30.0 Biostrings_2.46.0 [16] XVector_0.18.0 GenomicFeatures_1.30.3 AnnotationDbi_1.40.0 [19] Biobase_2.38.0 GenomicRanges_1.30.2 GenomeInfoDb_1.14.0 [22] IRanges_2.12.0 S4Vectors_0.16.0 BiocGenerics_0.24.0 [25] aroma.light_3.8.0 aroma.affymetrix_3.1.1 aroma.core_3.1.2 [28] R.devices_2.15.1 R.filesets_2.12.1 R.utils_2.6.0 [31] R.oo_1.22.0 affxparser_1.50.0 R.methodsS3_1.7.1 [34] BiocInstaller_1.28.0 loaded via a namespace (and not attached): [1] httr_1.3.1 RMySQL_0.10.14 splines_3.4.2 [4] bit64_0.9-7 assertthat_0.2.0 affy_1.56.0 [7] blob_1.1.1 GenomeInfoDbData_1.0.0 gcrma_2.50.0 [10] yaml_2.1.19 progress_1.2.0 globals_0.11.0 [13] RSQLite_2.1.0 lattice_0.20-35 RUnit_0.4.31 [16] digest_0.6.15 preprocessCore_1.40.0 XML_3.98-1.11 [19] pkgconfig_2.0.1 biomaRt_2.34.2 listenv_0.7.0 [22] zlibbioc_1.24.0 aroma.apd_0.6.0 affyio_1.48.0 [25] lava_1.6.1 BiocParallel_1.12.0 survival_2.42-3 [28] magrittr_1.5 crayon_1.3.4 memoise_1.1.0 [31] R.cache_0.13.0 R.rsp_0.42.0 tools_3.4.2 [34] prettyunits_1.0.2 hms_0.4.2 compiler_3.4.2 [37] rlang_0.2.1 grid_3.4.2 RCurl_1.95-4.10 [40] rstudioapi_0.7 R.huge_0.9.0 bitops_1.0-6 [43] base64enc_0.1-3 DNAcopy_1.52.0 codetools_0.2-15 [46] DBI_0.8 PSCBS_0.63.0 R6_2.2.2 [49] GenomicAlignments_1.14.1 rtracklayer_1.38.3 future.apply_0.2.0 [52] bit_1.1-12 stringi_1.2.2 Rcpp_0.12.17 -- -- When reporting problems on aroma.affymetrix, make sure 1) to run the latest version of the package, 2) to report the output of sessionInfo() and traceback(), and 3) to post a complete code example. You received this message because you are subscribed to the Google Groups "aroma.affymetrix" group with website http://www.aroma-project.org/. To post to this group, send email to aroma-affymetrix@googlegroups.com To unsubscribe and other options, go to http://www.aroma-project.org/forum/ --- You received this message because you are subscribed to the Google Groups "aroma.affymetrix" group. To unsubscribe from this group and stop receiving emails from it, send an email to aroma-affymetrix+unsubscr...@googlegroups.com. For more options, visit https://groups.google.com/d/optout.