Hi all, I have a string that is a random sequence like the following:-
ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? cheers Rob. =========================== Netnorth Limited 7-8 Queensbrook Bolton Technology Exchange Bolton BL1 4AY d/l: 01204 900714 tel: 01204 900700 Fax: 01204 900777 email: [EMAIL PROTECTED] =========================== ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Why not try our dial-up ? Modem Tel: 0845 055 0006 Username: netnorthdial Password: netnorthdial All formats supported, including V90, ISDN, ISDN dual channel, Mobile Phones ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
