In article <[EMAIL PROTECTED]>, Janek Schleicher wrote: > Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: > >> I have a string that is a random sequence like the following:- >> >> ACGTCGTCGTCACACACACGCGTCTCTATACGCG >> >> I want to be able to parse the string, picking out any TATA sequences, >> colour them in red and make a not of where ther lie in the sequence. >> >> Is this possible with perl? > > Yes, but you have to explain in what matter you want to colorize. > As output in a terminal window, as html/xml, as a picture, as a word > document ... .
And for those of us who want to do this as an exercise, what does "make a note mean" - something like: Line : Char Line 01: 27 or a multi-line char count (27,38,42,157...)? And will there ever be a "CGCGTCTCTATATACG..." (overlapping) and if so, should one list both starting points (or just non-overlapping matches)? As far as the color, I'm just going to use ANSI terminal codes. -- Kevin Pfeiffer International University Bremen -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
