Pattern matching problem

[Henry Todd]

I'm having trouble counting the number of specific substrings within a 
string. I'm working on a bioinformatics coursework at the moment, so my 
string looks like this:

$sequence = "caggaacttcccctcggaagaccatgta";

I want to count the number of occurrences of each pair of letters, for example:

Number of occurrences of "aa"
Number of occurrences of "gt"
Number of occurrences of "cc"
This is how I'm counting the number of "cc" pairs at the moment ($cc is 
my counter variable):

$cc++ while $sequence =~ /cc/gi;

But this only matches the literal string "cc", so if, as it scans 
$sequence, it finds "cccc" it's only counting it once instead of three 
times.

What pattern do I need to be looking for in the $sequence if I want to 
count *all* occurences of "cc" -- even if they overlap?

I apologise if this is an already documented problem, I've tried a 
number of Google Groups searches, as well as searches on 
learn.perl.org, but without finding an answer.

Many thanks for any help offered.

Henry.

--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>