Your message dated Mon, 26 Jan 2009 10:32:10 +0000
with message-id <[email protected]>
and subject line Bug#266921: fixed in bioperl 1.6.0-1
has caused the Debian Bug report #266921,
regarding bioperl: AlignIO::next_aln does not return multiple alignments for
bl2seq
to be marked as done.
This means that you claim that the problem has been dealt with.
If this is not the case it is now your responsibility to reopen the
Bug report if necessary, and/or fix the problem forthwith.
(NB: If you are a system administrator and have no idea what this
message is talking about, this may indicate a serious mail system
misconfiguration somewhere. Please contact [email protected]
immediately.)
--
266921: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=266921
Debian Bug Tracking System
Contact [email protected] with problems
--- Begin Message ---
Package: bioperl
Version: 1.4-1
Severity: normal
Hello,
Using the following program that is essentially taken from the AlignIO
documentation, only the first alignment of a series is actually read from a
bl2seq output file. Here is the program in full:
#!/usr/bin/perl -w
use Bio::AlignIO;
$inputfilename = "myalign.bl2seq";
$in = Bio::AlignIO->new(-file => $inputfilename, '-format' => 'bl2seq');
$out = Bio::AlignIO->new(-file => ">out.aln.fasta", '-format' => 'fasta');
while ( my $aln = $in->next_aln() ) {
$out->write_aln($aln);
}
I've attached the input file, as well as the output. Note that this problem
doesn't exist in the 1.2.1-2 package, and that the next_aln function did change
between these versions. I've found a reference to the problem on the bioperl
mailing list[0] but no one replied to it, and I can't find a reference to the
issue in the bioperl bugzilla (I'm not so good with bugzilla though, so I may
have missed it). I also can't get rid of the problem by updating to the latest
AlignIO/bl2seq.pm or SearchIO/blast.pm from CVS either. I'm going to try and
debug this further, but I'm at a loss right now, and any help would be
appreciated. Thanks!
- David Nusinow
[0] http://portal.open-bio.org/pipermail/bioperl-l/2004-August/016607.html
-- System Information:
Debian Release: 3.1
APT prefers unstable
APT policy: (500, 'unstable')
Architecture: i386 (i686)
Kernel: Linux 2.6.8-1-686
Locale: LANG=en_US.UTF-8, LC_CTYPE=en_US.UTF-8
Versions of packages bioperl depends on:
ii libgd-gd2-perl 1:2.15-1 Perl module wrapper for libgd - gd
ii libio-string-perl 1.05-1 Emulate IO::File interface for in-
ii libsoap-lite-perl 0.55-4 Perl5 modules for client and serve
ii perl [libstorable-perl] 5.8.4-2 Larry Wall's Practical Extraction
ii readseq 1-5 [Biology] Conversion between seque
-- no debconf information
>chromosome:DROM3A:2L:3512304:3560655:1/23787-23818
tcccattcccattccgatgcccaatcccaatc
>chromosome:DROM3A:3R:13896540:13979486:1/35825-35856
tcccattcccattccgaatccaaatcccaatc
Query= chromosome:DROM3A:2L:3512304:3560655:1 Drosophila melanogaster
chromosome 2L DROM3A partial sequence 3512304..3560655 reannotated via
EnsEMBL
(48,352 letters)
>chromosome:DROM3A:3R:13896540:13979486:1 Drosophila melanogaster
chromosome 3R DROM3A partial sequence 13896540..13979486
reannotated via EnsEMBL
Length = 82947
Score = 40.1 bits (20), Expect = 0.003
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 23787 tcccattcccattccgatgcccaatcccaatc 23818
||||||||||||||||| || ||||||||||
Sbjct: 35856 tcccattcccattccgaatccaaatcccaatc 35825
Score = 38.2 bits (19), Expect = 0.013
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 33086 ggatcggaatcggaatcgg 33104
|||||||||||||||||||
Sbjct: 65184 ggatcggaatcggaatcgg 65166
Score = 38.2 bits (19), Expect = 0.013
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 33086 ggatcggaatcggaatcggaattggaatcgg 33116
||||||| |||||||||||||| || |||||
Sbjct: 65190 ggatcgggatcggaatcggaatcgggatcgg 65160
Score = 38.2 bits (19), Expect = 0.013
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 23810 atcccaatcccattccgaatccgaatc 23836
|||||| ||||||||||||||| ||||
Sbjct: 35857 atcccattcccattccgaatccaaatc 35831
Score = 36.2 bits (18), Expect = 0.052
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 27441 cagcagcagttgcagcaa 27458
||||||||||||||||||
Sbjct: 61554 cagcagcagttgcagcaa 61571
Score = 34.2 bits (17), Expect = 0.20
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 47606 cagcaacagcaacaaca 47622
|||||||||||||||||
Sbjct: 60183 cagcaacagcaacaaca 60199
Score = 34.2 bits (17), Expect = 0.20
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 47606 cagcaacagcaacaacagccg 47626
|||||||| ||||||||||||
Sbjct: 60135 cagcaacaccaacaacagccg 60155
Score = 34.2 bits (17), Expect = 0.20
Identities = 24/25 (96%), Gaps = 1/25 (4%)
Strand = Plus / Plus
Query: 36158 taaatgtt-atatatttcttatata 36181
|||||||| ||||||||||||||||
Sbjct: 17277 taaatgttgatatatttcttatata 17301
Score = 34.2 bits (17), Expect = 0.20
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 15692 cgatttaaatgcaaatc 15708
|||||||||||||||||
Sbjct: 15354 cgatttaaatgcaaatc 15338
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 42102 tcgcataaataataat 42117
||||||||||||||||
Sbjct: 69500 tcgcataaataataat 69485
Score = 32.2 bits (16), Expect = 0.81
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 47603 caacagcaacagcaacaaca 47622
||||||||||| ||||||||
Sbjct: 60111 caacagcaacaacaacaaca 60130
Score = 32.2 bits (16), Expect = 0.81
Identities = 19/20 (95%)
Strand = Plus / Plus
Query: 47603 caacagcaacagcaacaaca 47622
||||| ||||||||||||||
Sbjct: 60105 caacaacaacagcaacaaca 60124
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 26877 atatatatttattttt 26892
||||||||||||||||
Sbjct: 50013 atatatatttattttt 49998
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 29050 gttaagtggacttctt 29065
||||||||||||||||
Sbjct: 30292 gttaagtggacttctt 30307
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 42443 tcttcggtgcagatta 42458
||||||||||||||||
Sbjct: 20206 tcttcggtgcagatta 20191
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 31404 atatgtatgtacatat 31419
||||||||||||||||
Sbjct: 19094 atatgtatgtacatat 19109
Score = 32.2 bits (16), Expect = 0.81
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 39181 tactcattcattcatt 39196
||||||||||||||||
Sbjct: 17645 tactcattcattcatt 17630
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 34708 ttttgttttatggtc 34722
|||||||||||||||
Sbjct: 81101 ttttgttttatggtc 81087
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 23465 agttgctttcattattatt 23483
||||||| |||||||||||
Sbjct: 78186 agttgctatcattattatt 78204
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 44921 atatatgtatatata 44935
|||||||||||||||
Sbjct: 68446 atatatgtatatata 68432
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 18391 aaatatgcaaatttg 18405
|||||||||||||||
Sbjct: 64713 aaatatgcaaatttg 64727
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 44921 atatatgtatatata 44935
|||||||||||||||
Sbjct: 64163 atatatgtatatata 64149
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 47602 gcaacagcaacagca 47616
|||||||||||||||
Sbjct: 61514 gcaacagcaacagca 61528
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 47606 cagcaacagcaacaacagc 47624
|||||||||||||| ||||
Sbjct: 61512 cagcaacagcaacagcagc 61530
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 47606 cagcaacagcaacaacagc 47624
||||| |||||||||||||
Sbjct: 60555 cagcagcagcaacaacagc 60573
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 27825 acaccagcaacagca 27839
|||||||||||||||
Sbjct: 60179 acaccagcaacagca 60193
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 14797 tgttgctgttgttgt 14811
|||||||||||||||
Sbjct: 60121 tgttgctgttgttgt 60107
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 30117 gctgctgcatccgcc 30131
|||||||||||||||
Sbjct: 56538 gctgctgcatccgcc 56552
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 35303 ttaataatttaatttgcca 35321
|||| ||||||||||||||
Sbjct: 55850 ttaacaatttaatttgcca 55832
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 18559 aaaacttaattaaaa 18573
|||||||||||||||
Sbjct: 54053 aaaacttaattaaaa 54067
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 33202 tataaaacatcaaca 33216
|||||||||||||||
Sbjct: 49000 tataaaacatcaaca 49014
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 4331 taaataaaaagtaca 4345
|||||||||||||||
Sbjct: 48897 taaataaaaagtaca 48883
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 10772 ctcagttttaagttt 10786
|||||||||||||||
Sbjct: 48309 ctcagttttaagttt 48323
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 44976 taaaataataataat 44990
|||||||||||||||
Sbjct: 45997 taaaataataataat 46011
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 24627 tgtgtttgcggaagt 24641
|||||||||||||||
Sbjct: 41183 tgtgtttgcggaagt 41197
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 10974 aattaaatgaatgaa 10988
|||||||||||||||
Sbjct: 37304 aattaaatgaatgaa 37290
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 41027 aaatatatgtataaa 41041
|||||||||||||||
Sbjct: 34364 aaatatatgtataaa 34350
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 44921 atatatgtatatata 44935
|||||||||||||||
Sbjct: 29900 atatatgtatatata 29886
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 17651 tattaaccaaaaagt 17665
|||||||||||||||
Sbjct: 25072 tattaaccaaaaagt 25086
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 14098 aataataataataac 14112
|||||||||||||||
Sbjct: 23005 aataataataataac 22991
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 9067 aatatagtgtatata 9081
|||||||||||||||
Sbjct: 22447 aatatagtgtatata 22461
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 31165 atacatacgtacatacata 31183
||||||| |||||||||||
Sbjct: 19113 atacatatgtacatacata 19095
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 12663 cgccaaactgaagga 12677
|||||||||||||||
Sbjct: 14229 cgccaaactgaagga 14215
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 18587 ggcgcacctaattaa 18601
|||||||||||||||
Sbjct: 13548 ggcgcacctaattaa 13534
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 10576 aattttttatatttt 10590
|||||||||||||||
Sbjct: 11733 aattttttatatttt 11747
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 42901 aattttgtaattttt 42915
|||||||||||||||
Sbjct: 11725 aattttgtaattttt 11739
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 36076 aaaattcatgaaaaa 36090
|||||||||||||||
Sbjct: 11730 aaaattcatgaaaaa 11716
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 31687 gttcccattcccgtt 31701
|||||||||||||||
Sbjct: 7332 gttcccattcccgtt 7318
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 35299 ttgtttaataattta 35313
|||||||||||||||
Sbjct: 3351 ttgtttaataattta 3337
Score = 30.2 bits (15), Expect = 3.2
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 25134 tttaaaaatattattaaat 25152
|||||||||||||| ||||
Sbjct: 3241 tttaaaaatattataaaat 3259
Score = 30.2 bits (15), Expect = 3.2
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 37630 attggcaacctaatc 37644
|||||||||||||||
Sbjct: 373 attggcaacctaatc 387
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3407
Number of Sequences: 0
Number of extensions: 3407
Number of successful extensions: 358
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 357
length of query: 48,352
length of database: 82,947
effective HSP length: 16
effective length of query: 48,336
effective length of database: 82,931
effective search space: 4008552816
effective search space used: 4008552816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)
--- End Message ---
--- Begin Message ---
Source: bioperl
Source-Version: 1.6.0-1
We believe that the bug you reported is fixed in the latest version of
bioperl, which is due to be installed in the Debian FTP archive:
bioperl_1.6.0-1.diff.gz
to pool/main/b/bioperl/bioperl_1.6.0-1.diff.gz
bioperl_1.6.0-1.dsc
to pool/main/b/bioperl/bioperl_1.6.0-1.dsc
bioperl_1.6.0-1_all.deb
to pool/main/b/bioperl/bioperl_1.6.0-1_all.deb
bioperl_1.6.0.orig.tar.gz
to pool/main/b/bioperl/bioperl_1.6.0.orig.tar.gz
A summary of the changes between this version and the previous one is
attached.
Thank you for reporting the bug, which will now be closed. If you
have further comments please address them to [email protected],
and the maintainer will reopen the bug report if appropriate.
Debian distribution maintenance software
pp.
Charles Plessy <[email protected]> (supplier of updated bioperl package)
(This message was generated automatically at their request; if you
believe that there is a problem with it please contact the archive
administrators by mailing [email protected])
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1
Format: 1.8
Date: Mon, 26 Jan 2009 12:58:28 +0900
Source: bioperl
Binary: bioperl
Architecture: source all
Version: 1.6.0-1
Distribution: experimental
Urgency: low
Maintainer: Debian-Med Packaging Team
<[email protected]>
Changed-By: Charles Plessy <[email protected]>
Description:
bioperl - Perl tools for computational molecular biology
Closes: 266921
Changes:
bioperl (1.6.0-1) experimental; urgency=low
.
[ Charles Plessy ]
* debian/control
- Updated dependancies according to the new upstream release.
- Added the CPAN dependancies of BioPerl to Build-Depends-Indep in order to
run the tests at build time.
- Added bioperl-run to the recommended packages.
- Updated my email address.
- Uses Debhelper 7 (debian/compat modified accordingly).
* debian/patches: removed as not needed (no downloads by default).
* debian/rules:
- Uses Build.PL instead of Makefile.PL.
- Tests disabled for the experimental upload: not all dependancies are
available yet.
* debian/README.{Debian,source}: removed as not needed anymore
* debian/watch: BioPerl is now mixed case.
.
[ David Paleino ]
* New upstream stable release:
- fixes Bio::AlignIO::next_aln bug (Closes: #266921).
- New modules, deprecated modules,… please consult Upsteam documents in
/usr/share/doc/bioperl.
* debian/control:
- fields values rewrapped to easily spot diffs in commit mails
- dropped B-D-I versioning on perl, since Etch already has a greater
version
- Standards-Version bumped to 3.8.0 (no changes needed).
Checksums-Sha1:
e12ac03df3656f7ec3f09e0616cdb2cb61bbd4c3 1886 bioperl_1.6.0-1.dsc
97c8380482211b7d67e0e92f61a7f4ef6b93ddcf 6813396 bioperl_1.6.0.orig.tar.gz
32c87f5fa4a703edb18a571cae7a6ad54af9c3ee 8531 bioperl_1.6.0-1.diff.gz
05cd7b4531dc0d9672687027bf36084d33d41688 6090962 bioperl_1.6.0-1_all.deb
Checksums-Sha256:
93c3d97068e44dd8787234fdd4a1ddc8aa9a804aff65bbf2787fb044ce61e20e 1886
bioperl_1.6.0-1.dsc
46d7fce2a20128f8515a9690feb27d9fd65023a2f85c83dca781d0aa1ba1e889 6813396
bioperl_1.6.0.orig.tar.gz
e258386dfb0fadeec3726c90bf268d1167ab3593655a01fc46817e60ddeb9abc 8531
bioperl_1.6.0-1.diff.gz
5ef9489537358cc9052f1bf63fb631c6bc67d237102b51af56543099f0792dcf 6090962
bioperl_1.6.0-1_all.deb
Files:
60c03d4dfe9ef01cde37807c96c9de5d 1886 science optional bioperl_1.6.0-1.dsc
ce38cba5f06aaf3c692c1a32218cde87 6813396 science optional
bioperl_1.6.0.orig.tar.gz
a9617b1bb74be34004a061970ee2b2e9 8531 science optional bioperl_1.6.0-1.diff.gz
9c9ca7d4d7aa387af268cc67740e9298 6090962 science optional
bioperl_1.6.0-1_all.deb
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.4.9 (GNU/Linux)
iEYEARECAAYFAkl9jBkACgkQdYl1krr+x/J6IgCfaJ3LAze9y7bnteDr3IeTXhKX
rOwAn0BYxcBLYKKtALdKasapYaZ4vGWD
=eCr+
-----END PGP SIGNATURE-----
--- End Message ---