Hi all, I used the vectorstrip to trim the 3' adapter off the sequences. But it seemed that the program searched for the existence of the entire adapter.
For example, if i have the read: CCCCCTTTTTAAAAAGGGGG And 3' adapter is: CCAAAGGG The program will not trim the read to CCCCCTTTTTAA Because it does not use the substring "AAAGGG" in the adapter sequence. Any comments about this? How can i trim only a substring of the adapter? I hope it can search for the longest match, but substring matches should also be accepted if no entire adapter is found in the sequence. Thanks! -Xiang _______________________________________________ EMBOSS mailing list EMBOSS@lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss
