Hi Dominique,
There are a few ways to do this.
If you have the data in fasta format in your history already, skip
converting to fasta-> tabular and just use that with the tool "FASTA
manipulation -> Compute sequence length". Then run the statistics tool
on the output.
Or, if this is the format you have to start with (tabular), the tool
"Text Manipulation -> Compute" can be used with the option "length(c2)"
to generate the length of column 2. Adjust the "c2" portion as needed if
this is not your complete file or if you had to do extra manipulations
to isolate these columns (potentially skip those steps and use the
earlier file).
Thanks!
Jen
Galaxy team
ps. This mailing list has moved to _/Galaxy Biostar/_ and will be
closing soon. Please join us there! Here is how to get set up:
https://wiki.galaxyproject.org/Support/Biostar
On 5/23/14 4:29 AM, Dominique Cowart wrote:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been divided into columns:
>HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT
I have attempted to use the "Summary Statistics" button, however it
appears to only be for numerical data and not sequence data. Is this
tool/task available
via Galaxy?
Thank you in advance,
Dominique Cowart
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
--
Jennifer Hillman-Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/
Posts to this list will be disabled in May 2014. In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.
For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
To search Galaxy mailing lists use the unified search at:
http://galaxyproject.org/search/mailinglists/
