Hi Dominique,
I’d use the original fasta file and input it into the 'Fasta Manipulation > 
Compute Sequence Length' tool
Then, using the output, run the 'Statistics > Summary Statistics for any 
numerical column' tool on c2.
That will give you all the info you’re after.
Cheers,
Graham

Dr. Graham Etherington
Bioinformatics Support Officer,
The Sainsbury Laboratory,
Norwich Research Park,
Norwich NR4 7UH.
UK
Tel: +44 (0)1603 450601
Twitter: @bioinformatiks

From: Dominique Cowart <[email protected]<mailto:[email protected]>>
Date: Friday, 23 May 2014 12:29
To: "[email protected]<mailto:[email protected]>" 
<[email protected]<mailto:[email protected]>>
Subject: [galaxy-user] Summary Statistics


Hello,

I am attempting to use Galaxy to calculate the mean sequence read length and 
identify the range of read lengths for my 454 data. The data has already been 
divided into columns:
>HD4AU5D01BHBCQC    TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
>HD4AU5D01A093MC    TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT


I have attempted to use the "Summary Statistics" button, however it appears to 
only be for numerical data and not sequence data. Is this tool/task available
via Galaxy?

Thank you in advance,


Dominique Cowart



___________________________________________________________
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014.  In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Reply via email to