To Whom It May Concern, I have a probe sequences, and I have mapped to chromosomal location, how can I find these sequences in the cDNA location? I have past the sequences into the UCSC genome browser, there is no problem to find their position in relation to the chromosomal location, but not to the the cDNA location. Thanks A_16_P17533794 H. sapiens AAAAGCACGCAATTACCATTAACTAGTTAGATGTGCCATTGTAGAATAGGTAGAGGATCC
chr6:46394321-46394380 A_16_P17533794 10143 false RCAN2 ref|NM_005822 Homo sapiens regulator of calcineurin 2 (RCAN2), mRNA. Sincerely, Juan Dong Instructor, Institute of Oral Health Research University of Alabama at Birmingham _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
