I could just guess what a field represents from the field name. But my
guess may not correct for corner cases. Could you let me know where
the description of the format is? Also, it seems that there are
different number of fields above '----' and below it. Why?

psLayout version 3

match   mis-    rep.    N's     Q gap   Q gap   T gap   T gap   strand  Q       
        Q       Q
        Q       T               T       T       T       block   blockSizes      
qStarts  tStarts
        match   match           count   bases   count   bases           name
        size    start   end     name            size    start   end     count
---------------------------------------------------------------------------------------------------------------------------------------------------------------
24      0       0       0       0       0       0       0       +       
test_sequence   25      1       25      chr1    75      26      50      1       
24,     1,      26,     ttgcaccggaaagtctgctccaga,       
ttgcaccggaaagtctgctccaga,

-- 
Regards,
Peng
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to