Hello Peng, pslx is the same as psl format with the sequence (query and target) included. This is noted in the BLAT documentation:
http://genome.ucsc.edu/goldenPath/help/blatSpec.html -out=type Controls output file format. Type is one of: psl - Default. Tab separated format, no sequence pslx - Tab separated format with sequence etc .............. FAQ for psl format: http://genome.ucsc.edu/FAQ/FAQformat.html#format2 21 columns for psl, 23 for pslx Hopefully this helps, Jennifer --------------------------------- Jennifer Jackson UCSC Genome Informatics Group http://genome.ucsc.edu/ On 4/21/10 8:50 AM, Peng Yu wrote: > I could just guess what a field represents from the field name. But my > guess may not correct for corner cases. Could you let me know where > the description of the format is? Also, it seems that there are > different number of fields above '----' and below it. Why? > > psLayout version 3 > > match mis- rep. N's Q gap Q gap T gap T gap strand Q > Q Q > Q T T T T block blockSizes > qStarts tStarts > match match count bases count bases > name > size start end name size start end count > --------------------------------------------------------------------------------------------------------------------------------------------------------------- > 24 0 0 0 0 0 0 0 + > test_sequence 25 1 25 chr1 75 26 50 1 > 24, 1, 26, ttgcaccggaaagtctgctccaga, > ttgcaccggaaagtctgctccaga, > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
