Hello Peng,

pslx is the same as psl format with the sequence (query and target) 
included. This is noted in the BLAT documentation:

http://genome.ucsc.edu/goldenPath/help/blatSpec.html

   -out=type   Controls output file format.  Type is one of:
                    psl - Default.  Tab separated format, no sequence
                    pslx - Tab separated format with sequence
                    etc ..............

FAQ for psl format:
http://genome.ucsc.edu/FAQ/FAQformat.html#format2

21 columns for psl, 23 for pslx

Hopefully this helps,
Jennifer

---------------------------------
Jennifer Jackson
UCSC Genome Informatics Group
http://genome.ucsc.edu/

On 4/21/10 8:50 AM, Peng Yu wrote:
> I could just guess what a field represents from the field name. But my
> guess may not correct for corner cases. Could you let me know where
> the description of the format is? Also, it seems that there are
> different number of fields above '----' and below it. Why?
>
> psLayout version 3
>
> match mis-    rep.    N's     Q gap   Q gap   T gap   T gap   strand  Q       
>         Q       Q
>       Q       T               T       T       T       block   blockSizes      
> qStarts  tStarts
>               match   match           count   bases   count   bases           
> name
>       size    start   end     name            size    start   end     count
> ---------------------------------------------------------------------------------------------------------------------------------------------------------------
> 24    0       0       0       0       0       0       0       +       
> test_sequence   25      1       25      chr1    75      26      50      1     
>   24,     1,      26,     ttgcaccggaaagtctgctccaga,       
> ttgcaccggaaagtctgctccaga,
>
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to