Hi, On the in-silico PCR input page there are two options: min perfect match & min good match. There are some explanations on the same page:
Min Perfect Match - Number of bases that match exactly on 3' end of primers. Minimum match size is 15. Min Good Match - Number of bases on 3' end of primers where at least 2 out of 3 bases match. So I would assume that if "min perfect match" is set to 15, then at least 15 bases counted from the 3' end of one primer must match the target: 5' CCCCCCCCCCCCCCCCCCCCC 3' primer || || ||||||||||||||| 3' CCACCTCCCCCCCCCCCCCCC 5' target If "min good match" is set to 15, then the 15 bases counted from the 3' end of one primer can have mismatch, but each mismatch must be compensated by 2 matches near by: 5' CCCCCCCCCCCCCCCCCCCCC 3' primer ||||||||| || || || || 3' CCACCTCCCTCCGCCTCCACC 5' target But how can these two options be specified simultaneously? will one option be overridden by another? Louis _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
