Hi, Louis! All conditions apply at once:
You must have valid forward and reverse primers matching to give a result. You must have primers that are least 15bp long. You must have at least 15 bp that match perfectly on the 3' end. You must have at least 15 bp that match "good" (2 out of 3) on the 3' end. This does allow you to increase Min Perfect Match above 15 if you want. It allows you to increase Min Good Match over Min Perfect Match if you want. But the specificity near the 3' end of the primers is always at least 15 bp perfectly matching. -Galt Ar 4/22/2010 12:24 AM, scríobh louis: > Hi, > > On the in-silico PCR input page there are two options: min perfect match > & min good match. There are some explanations on the same page: > > Min Perfect Match - Number of bases that match exactly on 3' end of > primers. Minimum match size is 15. > > Min Good Match - Number of bases on 3' end of primers where at least 2 > out of 3 bases match. > > So I would assume that if "min perfect match" is set to 15, then at > least 15 bases counted from the 3' end of one primer must match the > target: > > 5' CCCCCCCCCCCCCCCCCCCCC 3' primer > || || ||||||||||||||| > 3' CCACCTCCCCCCCCCCCCCCC 5' target > > If "min good match" is set to 15, then the 15 bases counted from the 3' > end of one primer can have mismatch, but each mismatch must be > compensated by 2 matches near by: > > 5' CCCCCCCCCCCCCCCCCCCCC 3' primer > ||||||||| || || || || > 3' CCACCTCCCTCCGCCTCCACC 5' target > > But how can these two options be specified simultaneously? will one > option be overridden by another? > > > Louis > > > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
