Hi, Mauro! In order to help, we need some more information:
What commandline was used to query with gfClient? What commandline was used to start gfServer? -Galt Mauro Donadello wrote: > Hi, > i've this sequence : >> hsa-mir-17 MI0000071 > GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC > > if I use hgBlat(webBlat) of our mirror , I obtain these results : > Genome:Human; Assembly:GRCh37/hg19 > > ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND > START END SPAN > --------------------------------------------------------------------------------------------------- > browser details hsa-mir-17 84 1 84 84 100.0% 13 + > 92002859 92002942 84 > browser details hsa-mir-17 33 10 56 84 89.2% X - > 133304255 133304300 46 > browser details hsa-mir-17 22 43 65 84 100.0% 6_qbl_hap6 + > 2248519 2248544 26 > browser details hsa-mir-17 22 43 65 84 100.0% 6_mann_hap4 > + 2303515 2303540 26 > > but when I use gfClient there are no results. > > gfClient and gfServer are compiled from 2.30 gb ucsc source code. > > Any idea ? > > Thanks a lot. > > > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
