Hi John, We do not construct the liftOvers to be reciprocal so it is not necessarily the case that those two regions would lift to each other both ways. However, from a cursory glance, it appears that they would lift to each other regardless. I am currently investigating this and hope to get back to you soon.
Best, Mary --------------------- Mary Goldman UCSC Bioinformatics Group On 7/15/10 1:31 PM, jdidion wrote: > Correction, the mm9 position is chr2:22770754-22770778. > > On Thu, 15 Jul 2010 16:29:02 -0400, jdidion<[email protected]> wrote: > >> I try to map the following positions from mm8 to mm9 using liftOver: >> chr2:22766881-22766905. liftOver reports that this has been deleted in >> > mm9. > >> So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in >> > mm9 > >> and get chr2:22766903-22766905. I think map this from mm9 to mm8 using >> liftOver and it returns my original query (chr2:22766881-22766905). >> >> I would expect liftOver to be reciprocal, but this appears not to be the >> case. Is there a reason for this, or is this a bug? >> >> Thanks >> >> John Didion >> > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
