Hi John,

We do not construct the liftOvers to be reciprocal so it is not 
necessarily the case that those two regions would lift to each other 
both ways. However, from a cursory glance, it appears that they would 
lift to each other regardless. I am currently investigating this and 
hope to get back to you soon.

Best,
Mary
---------------------
Mary Goldman
UCSC Bioinformatics Group

On 7/15/10 1:31 PM, jdidion wrote:
> Correction, the mm9 position is chr2:22770754-22770778.
>
> On Thu, 15 Jul 2010 16:29:02 -0400, jdidion<[email protected]>  wrote:
>    
>> I try to map the following positions from mm8 to mm9 using liftOver:
>> chr2:22766881-22766905. liftOver reports that this has been deleted in
>>      
> mm9.
>    
>> So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in
>>      
> mm9
>    
>> and get chr2:22766903-22766905. I think map this from mm9 to mm8 using
>> liftOver and it returns my original query (chr2:22766881-22766905).
>>
>> I would expect liftOver to be reciprocal, but this appears not to be the
>> case. Is there a reason for this, or is this a bug?
>>
>> Thanks
>>
>> John Didion
>>      
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>    
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to