Hi John, We have added a minor update to the methods we use to construct liftOvers between assemblies of the same species and have redone the mm8 to mm9 liftOver file. You should now be able to lift your area of interest from mm8 to mm9. Thank you for your patience with this issue.
Best, Mary --------------------- Mary Goldman UCSC Bioinformatics Group On 7/15/10 1:31 PM, jdidion wrote: > Correction, the mm9 position is chr2:22770754-22770778. > > On Thu, 15 Jul 2010 16:29:02 -0400, jdidion<[email protected]> wrote: > >> I try to map the following positions from mm8 to mm9 using liftOver: >> chr2:22766881-22766905. liftOver reports that this has been deleted in >> > mm9. > >> So I blat the sequence from that region (AATCCGTGCCAGAGCTACAGACGCT) in >> > mm9 > >> and get chr2:22766903-22766905. I think map this from mm9 to mm8 using >> liftOver and it returns my original query (chr2:22766881-22766905). >> >> I would expect liftOver to be reciprocal, but this appears not to be the >> case. Is there a reason for this, or is this a bug? >> >> Thanks >> >> John Didion >> > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
